BOC Sciences provides a wide range of research chemicals and biochemicals including inhibitors, building blocks, GMP Products, impurities and metabolites, APIs for Veterinary, Natural Compounds, ADCs, Stem Cell Molecule and chiral compounds.
| Product | Description | |
|---|---|---|
| Sekikaic acid | Synonyms: Benzoic acid, 2-hydroxy-3-[(2-hydroxy-4-methoxy-6-propylbenzoyl)oxy]-4-methoxy-6-propyl-; Sekikasaeure; 6-Hydroxy-5-(6-hydroxy-4-methoxy-2-propyl)-4-methoxy-2-propyl-benzoesaeure; 6-Oxy-4-methoxy-5-(6-oxy-4-methoxy-2-propyl-benzoyloxy)-2-propyl-benzoesaeure. CAS No. 607-11-4. Molecular formula: C22H26O8. Mole weight: 418.44. |  |
| Selank acetate | Selank acetate is a synthetic analog of human tuftsin and acts as a nootropic, anxiolytic peptide. Selank acetate is a typical anti-anxiety drug with no side effects. Synonyms: H-Thr-Lys-Pro-Arg-Pro-Gly-Pro-OH.CH3CO2H; L-Proline, 1-[N-[1-[N2-[1-(N2-L-threonyl-L-lysyl)-L-prolyl]-L-arginyl]-L-prolyl]glycyl]-, acetate salt; L-Threonyl-L-lysyl-L-prolyl-L-arginyl-L-prolylglycyl-L-proline acetate salt; Selanc acetate salt. Grades: ≥95%. CAS No. 2703745-90-6. Molecular formula: C33H57N11O9.C2H4O2. Mole weight: 811.93. | |
| Semax acetate | Semax acetate is a synthetic adrenocorticotropic hormone (ACTH) (4-10) peptide analog with neuroprotective, analgesic, and anti-anxiety properties. Synonyms: L-Proline, L-methionyl-L-α-glutamyl-L-histidyl-L-phenylalanyl-L-prolylglycyl-, acetate (1:1); H-Met-Glu-His-Phe-Pro-Gly-Pro-OH acetate; L-Methionyl-L-α-glutamyl-L-histidyl-L-phenylalanyl-L-prolylglycyl-L-proline acetate; L-Proline, 1-[N-[1-[N-[N-(N-L-methionyl-L-α-glutamyl)-L-histidyl]-L-phenylalanyl]-L-prolyl]glycyl]-, acetate. Grades: ≥95%. CAS No. 2828433-33-4. Molecular formula: C39H55N9O12S. Mole weight: 873.98. | |
| Septacidin | Septacidin is a glycoside antibiotic produced by the strain of Str. fimbriatus. It has anti-fungal effect. It inhibits L cells (NCTC 929) with ED50 of 25 ng/mL. It can inhibit sarcoma-180 and adenocarcinoma 755 cells in vivo. Synonyms: N-(1H-Purin-6-yl)-4-[[[(14-methyl-1-oxopentadecyl)amino]acetyl]amino]-4-deoxy-β-L-glycero-L-gluco-heptopyranosylamine; NSC-65104; L-glycero-β-L-gluco-Heptopyranosylamine, 4-deoxy-4-[[2-[(14-methyl-1-oxopentadecyl)amino]acetyl]amino]-N-9H-purin-6-yl-; Antibiotic LIA 0191A. Grades: 99%. CAS No. 62362-59-8. Molecular formula: C30H51N7O7. Mole weight: 621.77. | |
| SEPTIDE | Septide is a selective agonist for the tachykinin NK-1 receptor. It is also a selective agonist for the substance P P-receptor subtype. Synonyms: 5-Oxo-L-prolyl-L-phenylalanyl-L-phenylalanyl-L-prolyl-L-leucyl-L-methioninamide; Glp-phe-phe-pro-leu-met-NH2; (Pyr 6,Pro9)-Substance P (6-11). CAS No. 79775-19-2. Molecular formula: C39H53N7O7S. Mole weight: 763.95. | |
| [SER140]-PLP(139-151) acetate | [SER140]-PLP(139-151) acetate, a salt of [SER140]-PLP(139-151) that is a fragment of myelin proteolipid protein. Grades: >95.0%. Molecular formula: C74H108N20O19. Mole weight: 1581.77. | |
| (Ser8)-GLP-1 (7-36) amide (human, bovine, guinea pig, mouse, rat) | Serine substitution of alanine significantly improves the plasma stability of GLP-1(7-36) amide to DPP IV, but does not affect its insulinotropic activity. This may indicate that the modification can improve the potential of GLP-1 in the treatment of type 2 diabetes. Synonyms: (Ser79)-Proglucagon (78-107) amide (human, bovine, guinea pig, mouse, rat); H-His-Ser-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-Lys-Gly-Arg-NH2; L-Histidyl-L-seryl-L-α-glutamylglycyl-L-threonyl-L-phenylalanyl-L-threonyl-L-seryl-L-α-aspartyl-L-valyl-L-seryl-L-seryl-L-tyrosyl-L-leucyl-L-α-glutamylglycyl-L-glutaminyl-L-alanyl-L-alanyl-L-lysyl-L-α-glutamyl-L-phenylalanyl-L-isoleucyl-L-alanyl-L-tryptophyl-L-leucyl-L-valyl-L-lysylglycyl-L-argininamide; (Ser8)-Glucagon-Like Peptide 1 (7-36) amide; 8-L-Serine-36-L-argininamide-7-36-glucagon-like peptide I (human). Grades: 95%. CAS No. 215777-46-1. Molecular formula: C149H226N40O46. Mole weight: 3313.68. | |
| (Ser(Ac)3)-Ghrelin (mouse, rat) | Synonyms: H-Gly-Ser-Ser(Ac)-Phe-Leu-Ser-Pro-Glu-His-Gln-Lys-Ala-Gln-Gln-Arg-Lys-Glu-Ser-Lys-Lys-Pro-Pro-Ala-Lys-Leu-Gln-Pro-Arg-OH; glycyl-L-seryl-O-acetyl-L-seryl-L-phenylalanyl-L-leucyl-L-seryl-L-prolyl-L-alpha-glutamyl-L-histidyl-L-glutaminyl-L-lysyl-L-alanyl-L-glutaminyl-L-glutaminyl-L-arginyl-L-lysyl-L-alpha-glutamyl-L-seryl-L-lysyl-L-lysyl-L-prolyl-L-prolyl-L-alanyl-L-lysyl-L-leucyl-L-glutaminyl-L-prolyl-L-arginine. Grades: ≥95%. CAS No. 321974-76-9. Molecular formula: C141H233N45O42. Mole weight: 3230.64. | |
| (Ser(GlcNAc-β-D)236)-EMSY (230-240) | EMSY is a binding partner of BRCA2, a breast cancer susceptibility protein involved in double-stranded DNA repair. EMSY is thought to play a role in maintaining the stability of genomics in the M-phase. Synonyms: H-Thr-Ile-Thr-Val-Pro-Val-Ser(GlcNAc-β-D)-Gly-Ser-Pro-Lys-OH; L-Lysine, L-threonyl-L-isoleucyl-L-threonyl-L-valyl-L-prolyl-L-valyl-O-[2-(acetylamino)-2-deoxy-β-D-glucopyranosyl]-L-serylglycyl-L-seryl-L-prolyl-. Grades: ≥95%. CAS No. 2243207-03-4. Molecular formula: C56H97N13O21. Mole weight: 1288.46. | |
| Ser-Glu | Cas No. 6403-16-3. Molecular formula: C8H14N2O6. Mole weight: 234.21. | |
| Ser-His | Seryl-histidine is a dipeptide composed of serine and histidine. It is an incomplete breakdown product of protein digestion or protein catabolism. Synonyms: serylhistidine; L-seryl-L-histidine; L-Histidine, N-L-seryl-; SH dipeptide; L-Ser-L-His; Serine Histidine dipeptide; (S)-2-((S)-2-Amino-3-hydroxypropanamido)-3-(1H-imidazol-4-yl)propanoic acid. Grades: ≥95%. CAS No. 67726-09-4. Molecular formula: C9H14N4O4. Mole weight: 242.23. | |
| Ser-Leu | A substrate for human kidney dipeptidase. Synonyms: seryl-leucine; L-seryl-L-leucine; 4-fluoro-N-[[4-[[ (4-fluorophenyl) amino]methyl]phenyl]methyl]aniline; SL dipeptide; L-Ser-L-Leu; Serine Leucine dipeptide. CAS No. 6665-16-3. Molecular formula: C9H18N2O4. Mole weight: 218.25. | |
| Ser-phe | Synonyms: Serinylphenylalanine; L-seryl-L-phenylalanine; SF dipeptide; L-Ser-L-Phe; Serine Phenylalanine dipeptide; (S)-2-((S)-2-Amino-3-hydroxypropanamido)-3-phenylpropanoic acid. CAS No. 16875-28-8. Molecular formula: C12H16N2O4. Mole weight: 252.27. | |
| (Ser(PO3H2)202,Thr(PO3H2)205)-Tau Peptide (194-213) | Synonyms: H-Arg-Ser-Gly-Tyr-Ser-Ser-Pro-Gly-Ser(PO3H2)-Pro-Gly-Thr(PO3H2)-Pro-Gly-Ser-Arg-Ser-Arg-Thr-Pro-OH; L-arginyl-L-seryl-glycyl-L-tyrosyl-L-seryl-L-seryl-L-prolyl-glycyl-O-phosphono-L-seryl-L-prolyl-glycyl-O3-phosphono-L-threonyl-L-prolyl-glycyl-L-seryl-L-arginyl-L-seryl-L-arginyl-L-threonyl-L-proline. Grades: ≥95%. CAS No. 2022956-55-2. Molecular formula: C81H133N29O36P2. Mole weight: 2151.07. | |
| (Ser(PO3H2)273)-Nek11 (268-283) | In undisturbed and DNA-damaged cells, depletion of NEK11 prevents proteasome-dependent CDC25A degradation. NEK11 directly phosphorylates CDC25A, and CHK1 (checkpoint kinase 1) is activated directly by phosphorylation of NEK11 at Ser273. NEK11 is an important component of the G2/M checkpoint pathway, and genetic mutations in NEK11 may contribute to cancer development. Synonyms: H-Leu-Asn-Lys-Asn-Pro-Ser(PO3H2)-Leu-Arg-Pro-Ser-Ala-Ile-Glu-Ile-Leu-Cys-OH; L-Cysteine, L-leucyl-L-asparaginyl-L-lysyl-L-asparaginyl-L-prolyl-O-phosphono-L-seryl-L-leucyl-L-arginyl-L-prolyl-L-seryl-L-alanyl-L-isoleucyl-L-α-glutamyl-L-isoleucyl-L-leucyl-. Grades: ≥95%. CAS No. 2243207-06-7. Molecular formula: C77H135N22O26PS. Mole weight: 1848.09. | |
| (Ser(PO3H2)323)-Hrr25 (312-323) (S. cerevisiae) | Synonyms: H-Asp-Leu-Asn-Ala-Asn-Ser-Asn-Ala-Ala-Ser-Ala-Ser(PO3H2)-OH; L-Serine, L-α-aspartyl-L-leucyl-L-asparaginyl-L-alanyl-L-asparaginyl-L-seryl-L-asparaginyl-L-alanyl-L-alanyl-L-seryl-L-alanyl-O-phosphono-. Grades: ≥95%. CAS No. 2243207-04-5. Molecular formula: C43H72N15O24P. Mole weight: 1214.11. | |
| (Ser(PO3H2)396.404)-Tau Peptide (379-408) | Synonyms: H-Arg-Glu-Asn-Ala-Lys-Ala-Lys-Thr-Asp-His-Gly-Ala-Glu-Ile-Val-Tyr-Lys-Ser(PO3H2)-Pro-Val-Val-Ser-Gly-Asp-Thr-Ser(PO3H2)-Pro-Arg-His-Leu-OH; L-arginyl-L-alpha-glutamyl-L-asparagyl-L-alanyl-L-lysyl-L-alanyl-L-lysyl-L-threonyl-L-alpha-aspartyl-L-histidyl-glycyl-L-alanyl-L-alpha-glutamyl-L-isoleucyl-L-valyl-L-tyrosyl-L-lysyl-O-phosphono-L-seryl-L-prolyl-L-valyl-L-valyl-L-seryl-glycyl-L-alpha-aspartyl-L-threonyl-O-phosphono-L-seryl-L-prolyl-L-arginyl-L-histidyl-L-leucine. Grades: ≥95%. CAS No. 2022956-60-9. Molecular formula: C140H230N44O52P2. Mole weight: 3423.58. | |
| (Ser(PO3H2)516)-Artemis (511-523) | Artemis, a phosphorylated protein, plays a role in V(D)J recombination, non-homologous end-joining of double-strand breaks, and regulation of G2/M cell cycle checkpoints induced by DNA damage. Synonyms: H-Thr-Val-Ala-Gly-Gly-Ser(PO3H2)-Gln-Ser-Pro-Lys-Leu-Phe-Ser-OH; L-Serine, L-threonyl-L-valyl-L-alanylglycylglycyl-O-phosphono-L-seryl-L-glutaminyl-L-seryl-L-prolyl-L-lysyl-L-leucyl-L-phenylalanyl-. Grades: ≥95%. CAS No. 2243207-01-2. Molecular formula: C56H92N15O22P. Mole weight: 1358.41. | |
| Ser-Pro | Ser-Pro is a substrate for skin fibroblast prolidase. Synonyms: L-Proline, L-seryl-; serylproline; L-seryl-L-proline; (S)-1-((S)-2-Amino-3-hydroxypropanoyl)pyrrolidine-2-carboxylic acid; S-P Dipeptide; Serine Proline dipeptide. CAS No. 23827-93-2. Molecular formula: C8H14 N2 O4. Mole weight: 202.21. | |
| (Ser(tBu)6,Azagly10)-LHRH | (Ser(tBu)6,Azagly10)-LHRH is the impurity B of the Goserelin. Synonyms: (Ser(tBu)6)-Goserelin; Pyr-His-Trp-Ser-Tyr-Ser(tBu)-Leu-Arg-Pro-Azagly-NH2; L-pyroglutamyl-L-histidyl-L-tryptophyl-L-seryl-L-tyrosyl-O-tert-butyl-L-seryl-L-leucyl-L-arginyl-N'-carbamoyl-L-prolinehydrazide; Goserelin EP Impurity B; Goserelin Impurity 2; (2S)-N-[(2S,5S,8S,11S,14S,17S,20S)-25-Amino-20-({(2S)-2-[(2-carbamoylhydrazino)carbonyl]-1-pyrrolidinyl}carbonyl)-11-(4-hydroxybenzyl)-8-(hydroxymethyl)-1-(1H-imidazol-4-yl)-25-imino-5-(1H-indol-3-ylmethyl)-17-isobutyl-14-{[(2-methyl-2-propanyl)oxy]methyl}-3,6,9,12,15,18-hexaoxo-4,7,10,13,16,19,24-heptaazapentacosan-2-yl]-5-oxo-2-pyrrolidinecarboxamide. Grades: ≥95%. CAS No. 184686-52-0. Molecular formula: C59H84N18O14. Mole weight: 1269.41. | |
| Seryl-arginine | Seryl-arginine is a dipeptide composed of serine and arginase. Synonyms: Ser-Arg; L-Seryl-L-arginine. CAS No. 13261-11-5. Molecular formula: C9H19N5O4. Mole weight: 261.28. | |
| Seryl-isoleucine | Seryl-isoleucine is a dipeptide composed of serine and isoleucine. It is an incomplete breakdown product of protein digestion or protein catabolism. Synonyms: L-Isoleucine, L-seryl-; Ser-Ile; H-SI-OH; L-seryl-L-isoleucine; L-Ser-L-Ile. Grades: ≥95%. CAS No. 91086-51-0. Molecular formula: C9H18N2O4. Mole weight: 218.25. | |
| Seryl-lysine | Seryl-lysine is a dipeptide composed of serine and lysine. Synonyms: L-Serinyl-L-lysine; seryl lysine. CAS No. 22677-61-8. Molecular formula: C9H19N3O4. Mole weight: 233.26. | |
| Serylmethionine | Synonyms: Ser-met; L-Seryl-L-methionine; N-L-seryl-L-methionine; S-M Dipeptide; Serinyl-Methionine; Serine Methionine dipeptide. CAS No. 3227-9-6. Molecular formula: C8H16N2O4S. Mole weight: 236.29. | |
| Seryl-threonine | Seryl-threonine is a dipeptide composed of serine and threonine. It is an incomplete breakdown product of protein digestion or protein catabolism. Synonyms: L-Threonine, L-seryl-; L-seryl-L-threonine; Ser-Thr; Serinylthreonine; ST dipeptide; L-Ser-L-Thr. Grades: ≥95%. CAS No. 61043-85-4. Molecular formula: C7H14N2O5. Mole weight: 206.20. | |
| Seryl-tryptophan | Seryl-tryptophan is a dipeptide composed of serine and tryptophan. It is an incomplete breakdown product of protein digestion or protein catabolism. Synonyms: Ser-Trp-OH; Ser-Trp; L-Tryptophan, L-seryl-; Seryltryptophan; S-W Dipeptide; Serine Tryptophan dipeptide; L-seryl-L-tryptophan; H-SW-OH. Grades: ≥95%. CAS No. 94421-70-2. Molecular formula: C14H17N3O4. Mole weight: 291.30. | |
| Seryl-Valine | Seryl-Valine is a dipeptide composed of serine and valine. It is an incomplete breakdown product of protein digestion or protein catabolism. Synonyms: H-SV-OH; L-seryl-L-valine; L-Valine, L-seryl-; Serinyl-Valine; L-Ser-L-Val. Grades: ≥95%. CAS No. 51782-06-0. Molecular formula: C8H16N2O4. Mole weight: 204.22. | |
| Sevelamer HCl | Sevelamer HCl is a phosphate binding drug used to treat hyperphosphatemia via binding to dietary phosphate and prevents its absorption. Synonyms: 2-Propen-1-amine Hydrochloride polymer with 2-(Chloromethyl)oxirane; 2-Propen-1-amine Hydrochloride polymer with (Chloromethyl)oxirane; (Chloromethyl)oxirane polymer with 2-Propen-1-amine Hydrochloride; Allylamine Hydrochloride-epichlorhydrin Copolymer; Allylamine Hydrochloride-epichlorohydrin Copolymer; GT 16-026A; Phosblock; RenaGel. Grades: >98%. CAS No. 152751-57-0. Molecular formula: (C3H7N.C3H5ClO.HCl)x. Mole weight: 186.08. | |
| SF 2446A3 | Synonyms: SF2446A3. CAS No. 115834-24-7. Molecular formula: C26H21NO11. Mole weight: 523.4. | |
| SF 2446B2 | Synonyms: SF2446B2. Molecular formula: C34H35NO14. Mole weight: 681.6. | |
| (S)-Fesoterodine HCl | An impurity of Fesoterodine Fumarate. Fesoterodine Fumarate is an antimuscarinic agent and is rapidly de-esterified to its active metabolite 5-hydroxymethyl tolterodine that is a muscarinic receptor antagonist. Synonyms: 2-Methylpropanoic Acid 2-[(1S)-3-[Bis(1-methylethyl)amino]-1-phenylpropyl] -4-(hydroxymethyl)phenyl Ester HCl. Grades: > 95%. CAS No. 1294517-14-8. Molecular formula: C26H37NO3. HCl. Mole weight: 411.59 36.46. | |
| (S)-gama-amino-5-(dimethylamino)-2-thiophenepropanol | Grades: > 95%. CAS No. 1213343-71-5. Molecular formula: C9H16N2OS. Mole weight: 200.30. | |
| Shinorine | Shinorine, a mycosporine-like amino acid (MAA) and an analog of porphyra-344, is a small molecule sunscreen produced by some bacteria with antioxidant, anti-UV, and sun protection properties. Shinorine ameliorates chromium-induced toxicity in zebrafish hepatocytes through facultatively activating the Nrf2-Keap1-ARE pathway. Both porphyrin-334 and Shinorine antioxidants and direct antagonists of Keap1-Nrf2 binding. Shinorine may be an effective drug to prevent or delay the progression of a variety of degenerative aging diseases. Synonyms: L-Serine, N-[3-[(carboxymethyl)amino]-5-hydroxy-5-(hydroxymethyl)-2-methoxy-2-cyclohexen-1-ylidene]-; demethyl-analog of Porphyra 334; N-[3-[(Carboxymethyl)amino]-5-hydroxy-5-(hydroxymethyl)-2-methoxy-2-cyclohexen-1-ylidene]-L-serine. Grades: ≥95%. CAS No. 73112-73-9. Molecular formula: C13H20N2O8. Mole weight: 332.31. | |
| SHR-2042 | SHR-2042 is a novel glucagon-like peptide-1 recceptor agonist (GLP-1RA) with higher oral bioavailability. The oral bioavailability of SHR-2042 matched with SNAC is 3.39% (1:30, w/w) in monkeys, which is over 10 times higher than that of semaglutide. Synonyms: SHR 2042; SHR2042. | |
| Siastatin B | A-72363 B is a Heparanase inhibitor produced by Streptomyces nobilis SANK 60192. Synonyms: A-72363 B; 3-Piperidinecarboxylic acid, 6-(acetylamino)-4,5-dihydroxy-, (3S-(3-alpha,4-alpha,5-alpha,6-beta))-; Siastatin B microbial; (2s,3r,4s,5s)-2-(Acetylamino)-5-Carboxy-3,4-Dihydroxypiperidinium. Grades: 95%. CAS No. 54795-58-3. Molecular formula: C8H14N2O5. Mole weight: 218.21. | |
| S-Ibuprofen | S-Ibuprofen is a non-steroidal anti-inflammatory drug capable of inhibiting cyclooxygenase (COX) at clinically relevant concentrations. As an enantiomer of (R)-(-)-Ibuprofen, it more potently inhibits COX activity. Synonyms: (S)-Ibuprofen. Grades: > 95%. CAS No. 51146-56-6. Molecular formula: C13H18O2. Mole weight: 206.28. | |
| Sildenafil EP Impurity E | Cas No. 288-32-4. | |
| Simonyellin | Simonyellin is a naphthopyran from the lichen Simonyella variegata Steiner. CAS No. 173322-91-3. Molecular formula: C14H10O6. Mole weight: 274.23. | |
| SiRNA Negative Control | siRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. It is recommended as a negative control for evaluating RNAi off-target effects, and in order to verify the accuracy of gene specific siRNA dependent RNAi. Synonyms: RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA). Mole weight: 13323 ( AS: 6586.9; SS: 6736.1 ). | |
| SIYRY acetate | A Kb-restricted epitope peptide. Molecular formula: C52H75N11O15. Mole weight: 1094.25. | |
| S-Laropiprant | Synonyms: S-[4-(4-Chloro-benzyl)-7-fluoro-5-methanesulfonyl-1,2,3,3a,4,8b-hexahydro-cyclopenta[b]indol-3-yl]-acetic acid. Grades: > 95%. Molecular formula: C21H19ClFNO4S. Mole weight: 435.91. | |
| (S)-Lercanidipine HCl | A dihydropyridine calcium channel blocker. Synonyms: (4S)-1,4-Dihydro-2,6-dimethyl-4-(3-nittrophenyl)-3,5-pyridinedicarboxylic Acid 2-[(3,3-Diphenylpropyl)methylamino]-1,1-dimethylethyl Methyl Ester Hydrochloride. Grades: > 95%. CAS No. 184866-29-3. Molecular formula: C36H42ClN3O6. Mole weight: 648.19. | |
| SLLK-NH2, Control Peptide for TSP1 Inhibitor | SLLK-NH2, Control Peptide for TSP1 Inhibitor is a control peptide for LSKL (leucine-serine-lysine-leucine). Synonyms: SLLK, Control Peptide for TSP1 Inhibitor; H-Ser-Leu-Leu-Lys-NH2; L-seryl-L-leucyl-L-leucyl-L-lysinamide; SLLK-NH2. Grades: ≥95%. CAS No. 2918768-29-1. Molecular formula: C21H42N6O5. Mole weight: 458.60. | |
| SLLK-NH2, Control Peptide for TSP1 Inhibitor acetate | SLLK-NH2, Control Peptide for TSP1 Inhibitor acetate is a control peptide for LSKL (leucine-serine-lysine-leucine). Synonyms: H-Ser-Leu-Leu-Lys-NH2.CH3CO2H; L-seryl-L-leucyl-L-leucyl-L-lysinamide acetic acid; SLLK-NH2.CH3CO2H; SLLK, Control Peptide for TSP1 Inhibitor acetate. Grades: ≥95%. CAS No. 2918768-30-4. Molecular formula: C23H46N6O7. Mole weight: 518.66. | |
| (S)-Luliconazole-Z-Isomer | Grades: > 95%. Molecular formula: C14H9Cl2N3S2. Mole weight: 354.28. | |
| S-(+)-Manidipine | S-(+)-Manidipine is the (S)-Manidipine enantiomer. Uses: Antihypertensive agents. Synonyms: (4S)-1,4-Dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinedicarboxylic Acid 2-[4-(Diphenylmethyl)-1-piperazinyl]ethyl Methyl Ester; (+)-Manidipine. Grades: > 95%. CAS No. 126451-47-6. Molecular formula: C35H38N4O6. Mole weight: 610.7. | |
| (S)-(+)-Mephenytoin | (S)-(+)-Mephenytoin is an S-isomer of Mephenytoin, which is known to target sodium channel protein type 5 subunit alpha. Mephenytoin is a hydantoin-derivative anticonvulsant used to control various partial seizures. It is a substrate of the cytochrome P450 (CYP) isoform CYP2C19. It can be used to screen for such mutations by assaying its metabolites in urine. Synonyms: (S)-5-Ethyl-3-methyl-5-phenylhydantoin; (+)-Mephenytoin; (5S)-5-Ethyl-3-methyl-5-phenyl-2,4-imidazolidinedione. Grades: > 95%. CAS No. 70989-04-7. Molecular formula: C12H14N2O2. Mole weight: 218.26. | |
| S-Methyl-D/L-cysteine sulfoxide | Synonyms: (Methylsulfinyl)alanine; S-Methyl-D/L-Cysteine-S-oxide; S-Methylcysteine S-oxide; D/L-Alanine, 3-(methylsulfinyl)-; S-Methyl-DL-cysteine sulfoxide. Grades: ≥90%. Molecular formula: C4H9NO3S. Mole weight: 151.19. | |
| S-Metolachlor Metabolite CGA 368208 | Synonyms: Sodium [(2-ethyl-6-me- thylphenyl) carbamoyl] methane sulfonate. CAS No. 1173021-76-5. Mole weight: 279.29. | |
| S-Metolachlor Metabolite CGA 50720 | Synonyms: N-(2-Ethyl-6-methyl phenyl) oxamic acid. CAS No. 152019-74-4. Molecular formula: C11H13NO3. Mole weight: 207.23. | |
| (S)-Mosapride citrate | (S)-Mosapride citrate is an impurity of Mosapride. Mosapride is a 5-HT4 receptor agonist and 5-HT3 receptor antagonist. It is used as a gastroprokinetic agent. Synonyms: Benzamide, 4-amino-5-chloro-2-ethoxy-N-[[4-[(4-fluorophenyl)methyl]-2-morpholinyl]methyl]-, (S)-, 2-hydroxy-1,2,3-propanetricarboxylate (1:1); 4-Amino-5-chloro-2-ethoxy-N-{[(2S)-4-(4-fluorobenzyl)-2-morpholinyl]methyl}benzamide 2-hydroxy-1,2,3-propanetricarboxylate (1:1); (S)-4-amino-5-chloro-2-ethoxy-N-((4-(4-fluorobenzyl)morpholin-2-yl)methyl)benzamide citrate. Grades: ≥95%. CAS No. 156925-25-6. Molecular formula: C21H25ClFN3O3.C6H8O7. Mole weight: 614.02. | |
| S-MTC | S-MTC is a selective type I nitric oxide synthase (NOS) inhibitor. Uses: Enzyme inhibitors. Synonyms: L-Ornithine, N5-[imino(methylthio)methyl]-; N5-[Imino(methylthio)methyl]-L-ornithine; (S)-2-Amino-5- ( (imino (methylthio)methyl)amino)pentanoic acid; S-Methyl-L-thiocitrulline; S-Methylthiocitrulline; L-S-Methylthiocitrulline; N(delta)-(S-Methylisothioureido)norvaline. Grades: ≥95%. CAS No. 156719-41-4. Molecular formula: C7H15N3O2S. Mole weight: 205.28. | |
| SNAP8 acetate | SNAP8 acetate is a mimic of the N-terminal end of SNAP-25 which competes with SNAP-25 for a position in the SNARE complex, thereby modulating its formation and preventing the formation of lines and wrinkles. Synonyms: N-Acetyl-L-α-glutamyl-L-α-glutamyl-L-methionyl-L-glutaminyl-L-arginyl-L-arginyl-L-alanyl-L-α-asparagine acetate salt; Acetyl octapeptide 1 acetate salt; Acetyl octopeptide 3 acetate salt; Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2.CH3CO2H. Grades: ≥95%. Molecular formula: C43H74N16O18S. Mole weight: 1135.21. | |
| SnapIt | Synonyms: H-DL-β-(5-Norbornen-2-yl)-DL-Ser-OH; 2-amino-3-(bicyclo[2.2.1]hept-5-en-2-yl)-3-hydroxypropanoic acid. Molecular formula: C10H15NO3. Mole weight: 197.23. | |
| (S)-N-Fmoc-[2-(4-pyridyl)ethyl]glycine | (S)-N-Fmoc-[2-(4-pyridyl)ethyl]glycine is a protected pyridylethylglycine used in the design and synthesis of peptide-doxorubicin prodrugs as antitumor agents. Synonyms: (αS)-α-[[(9H-Fluoren-9-ylmethoxy)carbonyl]amino]-4-pyridinebutanoic Acid; N-(fluorenylmethoxycarbonyl)-(2S)-4-pyrid-4-yl-2-aminobutyric acid; Fmoc-Abu(4-pyridyl)-OH; (S)-2-((((9H-Fluoren-9-yl)methoxy)carbonyl)amino)-4-(pyridin-4-yl)butanoic acid; 4-Pyridinebutanoic acid, α-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-, (αS)-; (2S)-2-{[(9H-Fluoren-9-ylmethoxy)(hydroxy)methylene]amino}-4-(4-pyridinyl)butanoic acid. Grades: ≥95%. CAS No. 273222-04-1. Molecular formula: C24H22N2O4. Mole weight: 402.44. | |
| sn-Glycero-3-phosphocholine | sn-Glycero-3-phosphocholine is a nootropic phospholipid and acts as a precursor to choline biosynthesis. sn-Glycero-3-phosphocholine is an intermediate in catabolic pathway of phosphatidylcholine. Nutritional supplement in health care products. Uses: Ingredient of health care products. Synonyms: Choline alfoscerate; (R) -2-[[ (2, 3-Dihydroxypropoxy) hydroxyphosphinyl]oxy]-N, N, N-trimethylethanaminium Inner Salt; 2- [ [ [ (2R) -2, 3-Dihydroxypropoxy] hydroxyphosphinyl] oxy] -N, N, N-trimethylethanaminium Inner Salt; Brezal; Cereton; Cholicerin; Cholitiline; Delecit; Glycerylphosphocholine; L-α-GPC; L-α-Glycerophosphocholine; L-α-Glycerylphosphorylcholine; O-(sn-glycero-3-Phosphoryl)choline; Sn-Glycerophosphocholine; sn-Glycero-3-phosphorylcholine; α-Glycerophosphorylcholine; α-Glycerylphosphorylcholine. Grades: ≥95%. CAS No. 28319-77-9. Molecular formula: C8H20NO6P. Mole weight: 257.22. | |
| (S)-O-Desmethyl Rabeprazole Impurity | S enantiomer of O-Desmethyl Rabeprazole.O-Desmethyl Rabeprazole is an impurity of Rabeprazole. Rabeprazole is proton pump inhibitor as an antiulcer drug. Grades: > 95%. CAS No. 179952-05-7. Molecular formula: C17H19N3O3S. Mole weight: 345.42. | |
| Sodium 1-(tert-butoxycarbonyl)azetidine-3-sulfinate | Synonyms: Sodium N-Boc-azetidine-3-sulfinate; 1-(tert-Butoxycarbonyl)azetidine-3-sulfinic acid sodium salt; Baran AZS-Na Reagent; 1-Azetidinecarboxylic acid, 3-sulfino-, 1-(1,1-dimethylethyl) ester, sodium salt (1:1). Grades: ≥95%. CAS No. 1622013-57-3. Molecular formula: C8H14NNaO4S. Mole weight: 243.26. | |
| Sodium 4,4-difluorocyclohexanesulfinate | Synonyms: 4,4-Difluorocyclohexane-1-sulfinic acid sodium salt; Sodium 4,4-difluorocyclohexan-1-sulfinate; Cyclohexanesulfinic acid, 4,4-difluoro-, sodium salt (1:1); Baran DFHS-Na Reagent. Grades: ≥95%. CAS No. 1622013-58-4. Molecular formula: C6H9F2NaO2S. Mole weight: 206.19. | |
| Sodium fluoromethanesulfinate | Synonyms: Methanesulfinic acid, 1-fluoro-, sodium salt (1:1); Fluoromethanesulfinic acid, sodium salt. Grades: ≥95%. CAS No. 1661836-10-7. Molecular formula: CH2FNaO2S. Mole weight: 120.08. | |
| Sodium L-Aspartate | Synonyms: L-Aspartic Acid Sodium Salt; Aspartic Acid Monosodium Salt; Monosodium Aspartate; Butanedioate, 2-amino-, sodium salt, (2S)- (1:1); Sodium hydrogen L-aspartate. Grades: 98%. CAS No. 3792-50-5. Molecular formula: C4H6NNaO4. Mole weight: 155.08. | |
| Sodium tetrahydrofuransulfinate | Synonyms: Baran TFHS-Na Reagent; Sodium oxolane-3-sulfinate; Sodium tetrahydrofuran-3-sulfinate; Tetrahydrofuran-3-sulfinic acid sodium salt; 3-Furansulfinic acid, tetrahydro-, sodium salt (1:1); Sodium 3-tetrahydrofurane sulfinate. Grades: ≥95%. CAS No. 1622013-59-5. Molecular formula: C4H7NaO3S. Mole weight: 158.15. | |
| Sodium tetrahydropyransulfinate | Synonyms: Tetrahydro-2H-pyran-4-sulfinic acid sodium salt; Sodium oxane-4-sulfinate; Baran THPS-Na Reagent; 2H-Pyran-4-sulfinic acid, tetrahydro-, sodium salt (1:1). Grades: ≥95%. CAS No. 1516140-99-0. Molecular formula: C5H9NaO3S. Mole weight: 172.18. | |
| Sodium tungstate(VI) | Sodium tungstate(VI) is a decatungstate photocatalyst for trifluoromethylation of aliphatic C-H bonds and selective C-H fluorination of unprotected peptides. Uses: Transition metal catalysts. Synonyms: Tungstate (W10O324-), sodium (1:4); Tungstate (W10O324-), tetrasodium; Sodium decatungstate Na4W10O32; Sodium tungstate (Na4W10O32); NaDT; Sodium decatungstate. Grades: ≥95%. CAS No. 126752-51-0. Molecular formula: Na.1/4O32W10. Mole weight: 2442.36. | |
| S(OH), R-Metconazole ((-)-cis-5-[(4-chlorophenyl)methyl]-2,2-dimethyl-1-(1H-1,2,4-triazole-1-ylmethyl]cyclopentanol) | Grades: > 95%. Molecular formula: C17H22ClN3O. Mole weight: 319.84. | |
| Solid Acrylic Resin | It can be used for coil coating, OPP matte varnish, cosmetics, ball finish for coils, diffusion film, etc. | |
| Somatostatin-14 (3-14) | Somatostatin-14 (3-14) is an exquisite peptide analog harnessed extensively for biomedical research, epitomizes a remarkable resemblance to the native hormone somatostatin. Exerting its influence as an agonist dedicated to specific somatostatin receptors, this product exudes exquisite potential in unveiling the intricacies of ailments such as acromegaly, carcinoid syndrome and pancreatic neuroendocrine tumors, all intertwined with the enigmatic somatostatin receptors. Synonyms: H-D-Cys-D-Lys-Asn-Phe-Phe-D-Trp-Lys-Thr-D-Phe-Thr-Ser-Cys-OH (Disulfide bridge: Cys1-Cys12); D-cysteinyl-D-lysyl-L-asparagyl-L-phenylalanyl-L-phenylalanyl-D-tryptophyl-L-lysyl-L-threonyl-D-phenylalanyl-L-threonyl-L-seryl-L-cysteine (1->12)-disulfide; 1,2-Dithia-5,8,11,14,17,20,23,26,29,32,35-undecaazacyclooctatriacontane-4-carboxylic acid, 37-amino-19,34-bis(4-aminobutyl)-31-(2-amino-2-oxoethyl)-10,16-bis[(1R)-1-hydroxyethyl]-7-(hydroxymethyl)-22-(1H-indol-3-ylmethyl)-6,9,12,15,18,21,24,27,30,33,36-undecaoxo-13,25,28-tris(phenylmethyl)-, (4R, 7S, 10S, 13R, 16S, 19S, 22R, 25S, 28S, 31S, 34R, 37S)-. Grades: ≥95%. CAS No. 54518-51-3. Molecular formula: C71H96N16O17S2. Mole weight: 1509.77. | |
| Somatostatin-28 | Somatostatin-28 is an exceptionally significant neuropeptide hormone extensively employed in the compound field, acting as a superbly adept endogenous modulator of neurotransmitters and hormones. Synonyms: Prosomatostatin; 73032-94-7; Somatostatin 28; Somatostatin-28 (sheep) 28; UNII-14EBZ2F8O6; 14EBZ2F8O6; SRIF-28; SOMATOSTATIN 28, CYCLIC; Somatostatin 28, >=97% (HPLC); LS-15547; LS-145641; FT-0689038. Grades: ≥95%. CAS No. 75037-27-3. Molecular formula: C137H207N41O39S3. Mole weight: 3148.6. | |
| Somatostatin-28 (sheep) | Somatostatin-28 (sheep) is derived from posttranslational cleavage of prosomatostatin, which in turn is derived from a larger precursor, preprosomatostatin. S-28 is an octacosapeptide first isolated from the duodenum of pigs. Unlike S-14, S-28 increases amylase secretion, cellular cyclic GMP and Ca2+ outfluxes in the guinea pig pancreatic acini. Synonyms: H-Ser-Ala-Asn-Ser-Asn-Pro-Ala-Met-Ala-Pro-Arg-Glu-Arg-Lys-Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys-OH (Disulfide bridge: Cys17-Cys28); Somatostatin 1-28; L-seryl-L-alanyl-L-asparagyl-L-seryl-L-asparagyl-L-prolyl-L-alanyl-L-methionyl-L-alanyl-L-prolyl-L-arginyl-L-alpha-glutamyl-L-arginyl-L-lysyl-L-alanyl-glycyl-L-cysteinyl-L-lysyl-L-asparagyl-L-phenylalanyl-L-phenylalanyl-L-tryptophyl-L-lysyl-L-threonyl-L-phenylalanyl-L-threonyl-L-seryl-L-cysteine (17->28)-disulfide; 1,2-Dithia-5,8,11,14,17,20,23,26,29,32,35-undecaazacyclooctatriacontane, cyclic peptide deriv.; Cyclic somatostatin-28; Human somatostatin-28; Somatostatin-28 (human); Somatostatin-28 (pig); Somatostatin-28 (rat); Somatostatin-28 (sheep reduced), cyclic (17?28)-disulfide. Grades: ≥95% by HPLC. CAS No. 73032-94-7. Molecular formula: C137H207N41O39S3. Mole weight: 3148.56. | |
| Sonolisib | Sonolisib, also known as PX-866, is a small-molecule wortmannin analogue inhibitor of the alpha, gamma, and delta isoforms of phosphoinositide 3-kinase (PI3K) with potential antineoplastic activity. PI3K inhibitor PX-866 inhibits the production of the secondary messenger phosphatidylinositol-3,4,5-trisphosphate (PIP3) and activation of the PI3K/Akt signaling pathway, which may result in inhibition of tumor cell growth and survival in susceptible tumor cell populations. Activation of the PI3K/Akt signaling pathway is frequently associated with tumorigenesis and dysregulated PI3K/Akt signaling may contribute to tumor resistance to a variety of antineoplastic agents. Uses: Potential anti-cancer agent. Synonyms: PX-866; PX866; PX 866. Grades: >98%. CAS No. 502632-66-8. Molecular formula: C29H35NO8. Mole weight: 525.59. | |
Our database is helping our users find suppliers everyday.
