American Chemical Suppliers
A directory of where to buy chemicals in the USA, including: distributors, industrial manufacturers, bulk supplies and wholesalers of raw ingredients & finished goods.
Search for products or services, then visit the suppliers website for prices or more information.
Product | Description | |
---|---|---|
SiO2 coated upconverting (near-infrared light) Quick inquiry Where to buy Suppliers range | SiO2 coated upconverting (near-infrared light). Group: Series of Graphene Quantum Dots. | |
SiO2-COOH modified upconverting (blue light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting (blue light). Group: Series of Graphene Quantum Dots. | |
SiO2-COOH modified upconverting (green light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting (green light). Group: Series of Graphene Quantum Dots. | |
SiO2-COOH Modified Upconverting Nanoparticles Quick inquiry Where to buy Suppliers range | SiO2-COOH Modified Upconverting Nanoparticles. Uses: Fluorescence imaging,biodetection, photodynamic therapy, photoactivation of anti-cancer drugs and biomolecules etc. CAS No. 7681-49-4(Sodium fluoride). Product ID: ACM7681494-5. Appearance: Ivory white solution. Solubility: Water or aqueous medium. | |
SiO2-COOH modified upconverting nanoparticles (near-infrared light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting nanoparticles (near-infrared light). Product ID: ACMA00021306. | |
SiO2-COOH modified upconverting nanoparticles (purple-blue light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting nanoparticles (purple-blue light). Product ID: ACMA00021307. | |
SiO2-COOH modified upconverting nanoparticles (Yellow green light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting nanoparticles (Yellow green light). Product ID: ACMA00021308. | |
SiO2-COOH modified upconverting (near-infrared? Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting (near-infrared?. Group: Series of Graphene Quantum Dots. | |
SiO2-COOH modified upconverting (red light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting (red light). Group: Series of Graphene Quantum Dots. | |
SiO2-COOH modified upconverting (UV light) Quick inquiry Where to buy Suppliers range | SiO2-COOH modified upconverting (UV light). Group: Series of Graphene Quantum Dots. | |
SiO2 NanoFibers Quick inquiry Where to buy Suppliers range | SiO2 NanoFibers. Product ID: ACMA00018381. Density: 10 - 30 nm x 100 - 500 nm. | |
SiO2-NH2 modified upconverting (blue light) Quick inquiry Where to buy Suppliers range | SiO2-NH2 modified upconverting (blue light). Group: Series of Graphene Quantum Dots. | |
SiO2-NH2 modified upconverting (green light) Quick inquiry Where to buy Suppliers range | SiO2-NH2 modified upconverting (green light). Group: Series of Graphene Quantum Dots. | |
SiO2-NH2 modified upconverting nanoparticles(Purple-blue light) Quick inquiry Where to buy Suppliers range | SiO2-NH2 modified upconverting nanoparticles(Purple-blue light). Product ID: ACMA00021309. | |
SiO2-NH2 modified upconverting(near-infrared light) Quick inquiry Where to buy Suppliers range | SiO2-NH2 modified upconverting(near-infrared light). Group: Series of Graphene Quantum Dots. | |
SiO2-NH2 modified upconverting(red light) Quick inquiry Where to buy Suppliers range | SiO2-NH2 modified upconverting(red light). Group: Series of Graphene Quantum Dots. | |
SiO2-NH2 modified upconverting (UV light) Quick inquiry Where to buy Suppliers range | SiO2-NH2 modified upconverting (UV light). Group: Series of Graphene Quantum Dots. | |
SiO2, Quarz, monokrist. SUS-sample Quick inquiry Where to buy Suppliers range | SiO2, Quarz, monokrist. SUS-sample. Uses: For analytical and research use. Group: Process Materials, Geological, Cement & Soils; XRF Monitor Glasses. Catalog: APS003061. Format: Solid. Shipping: Room Temperature. | |
Si-OMeTPA Quick inquiry Where to buy Suppliers range | Si-OMeTPA. Uses: This is a dopant free, high-performance hole transport material having outstanding performance compared to SpiroMeOTAD. Group: Hole Transport Materials. Molecular Weight: 1245.54. | |
Siomycin Quick inquiry Where to buy Suppliers range | Siomycin. Uses: Microbial Fermentation Products. CAS No. 11017-43-9. Product ID: MFP-065. | |
Siomycin Quick inquiry Where to buy Suppliers range | Siomycin is a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G and aminoacyl-tRNA. It exhibits antitumor activity against certain cancer cell lines. CAS No. 11017-43-9. Molecular formula: C64H88N16O22S4. Mole weight: 1561.73. | |
Siomycin A Quick inquiry Where to buy Suppliers range | A macrocyclic antibiotic first isolated from S. sioyaensis with potent and selective antibacterial activity. It is a potent inhibitor of the oncogenic transcription factor, foxm1. It inhibits foxm1-induced cell growth on soft agar and selectively kills transformed but not normal cells in vitro. Synonyms: Mutabilycin; Sporangiomycin; 6741-21; NSC 285116; Antibiotic 6741-21; (1-L-valine)-[2-(2,3-didehydro-alanine)]-thiostrepton; Thiostrepton, 1-Valine-2-(2,3-didehydroalanine)-. Grades: >95% by HPLC. CAS No. 12656-09-6. Molecular formula: C71H81N19O18S5. Mole weight: 1648.84. | |
Siomycin A (Mutabilycin, Sporangiomycin, Antibiotic 6741-21, Mutabillicin) Quick inquiry Where to buy Suppliers range | Siomycin A (Mutabilycin, Sporangiomycin, Antibiotic 6741-21, Mutabillicin). Group: Biochemicals. Alternative Names: Mutabilycin, Sporangiomycin, Antibiotic 6741-21, Mutabillicin. Grades: Highly Purified. CAS No. 12656-09-6. Pack Sizes: 500ug. US Biological Life Sciences. | Worldwide |
SiO?/Si wafer Quick inquiry Where to buy Suppliers range | SiO2/Si wafer. Product ID: ACMA00020876. | |
Sipatrigine Quick inquiry Where to buy Suppliers range | Sipatrigine is a blocker of voltage-dependent sodium channels (NaV) and a glutamate release inhibitor. Sipatrigine exhibits neuroprotective activity in rat models of cerebral ischemia. It was also reported to block Ca2+ channels. Uses: Neuroprotective agents. Synonyms: 619C; 619C-89; BW-619C-89; BW-619C89; 619 C; 619C 89; BW 619C-89; BW 619C89; 619C; 619C89; BW619C89; 2-(4-Methyl-1-piperazinyl)-5-(2,3,5-trichlorophenyl)-4-pyrimidinamine. Grades: ≥99% by HPLC. CAS No. 130800-90-7. Molecular formula: C15H16Cl3N5. Mole weight: 372.68. | |
Sipatrigine Quick inquiry Where to buy Suppliers range | Sipatrigine. Group: Biochemicals. Grades: Purified. CAS No. 130800-90-7. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
Sipeimine (Imperialine) Quick inquiry Where to buy Suppliers range | Sipeimine (Imperialine). Group: Biochemicals. Alternative Names: Sipeimine; Kashmirine. Grades: Plant Grade. CAS No. 61825-98-7. Pack Sizes: 20mg. Molecular Formula: C27H43NO3, Molecular Weight: 429.634999999999. US Biological Life Sciences. | Worldwide |
Siponimod Quick inquiry Where to buy Suppliers range | Siponimod is a selective S1P1 and S1P5 agonist with EC50 of 0.39 nM and 0.98 nM, respectively. It has been approved by US FDA for the treatment of patients with active secondary progressive multiple sclerosis (SPMS). Synonyms: BAF-312; BAF 312; BAF312; Siponimod; Mayzent; 1-[[4-[(E)-N-[[4-cyclohexyl-3-(trifluoromethyl)phenyl]methoxy]-C-methylcarbonimidoyl]-2-ethylphenyl]methyl]azetidine-3-carboxylic acid. Grades: >98%. CAS No. 1230487-00-9. Molecular formula: C29H35F3N2O3. Mole weight: 516.6. | |
Siramesine Quick inquiry Where to buy Suppliers range | Siramesine is a selective sigma-2 receptor agonist with a potent anticancer activity in vivo. It was originally devevloped for treating depressant and it has pro-apoptotic activity on various transformed cell types. Synonyms: 1'-[4-[1-(4-fluorophenyl)indol-3-yl]butyl]spiro[1H-2-benzofuran-3,4'-piperidine] 1-(4-fluorophenyl)-3-(4-(4-(4-fluorophenyl)-1-piperidinyl)-1-butyl)-1H-indole Lu 28-179 Lu-28-179 Siramesine. CAS No. 147817-50-3. Molecular formula: C30H31FN2O. Mole weight: 454.58. | |
Siramesine fumarate Quick inquiry Where to buy Suppliers range | Siramesine is a sigma receptor agonist with selectivity for σ2 over σ1 (IC50 = 0.19 and 17 nM, respectively). It exhibits anxiolytic and antidepressant effects. Siramesine has been shown to trigger cell death of cancer cells and to exhibit a potent anticancer activity in vivo. Synonyms: Lu 28-179; Siramesine fumarate salt; 1'-[4-[1-(4-fluorophenyl)indol-3-yl]butyl]spiro[1H-2-benzofuran-3,4'-piperidine] fumarate. Grades: ≥98%. CAS No. 163630-79-3. Molecular formula: C30H31FN2O·C4H4O4. Mole weight: 570.7. | |
Siramesine hydrochloride Quick inquiry Where to buy Suppliers range | Siramesine hydrochloride is the hydrochloride salt form of Siramesine. Siramesine is a selective sigma-2 receptor agonist with potent anticancer activity in vivo. It was originally devevloped for treating depressant. Synonyms: Siramesine (hydrochloride); Siramesine HCl; Lu-28-179; Lu 28-179; Lu28-179; Lu-28179; Lu 28179; Lu28179. CAS No. 224177-60-0. Molecular formula: C30H32ClFN2O. Mole weight: 491.04. | |
Sirius Red ≥21% (Dye content) Quick inquiry Where to buy Suppliers range | Sirius Red ≥21% (Dye content). Group: Biochemicals. Grades: Reagent Grade. Pack Sizes: 25g, 100g, 250g. US Biological Life Sciences. | Worldwide |
Sirius Red Powder C.I. 35780 Quick inquiry Where to buy Suppliers range | 25g Pack Size. Group: Analytical Reagents, Stains & Indicators. Formula: C45H32N10O21S6. CAS No. 2610-10-8. Prepack ID 90028587-25g. Molecular Weight 1373.05. See USA prepack pricing. | |
SIRIUS SUPRA RED VIOLET B Quick inquiry Where to buy Suppliers range | SIRIUS SUPRA RED VIOLET B. Group: Direct Dyes. Alternative Names: SIRIUS SUPRA RED VIOLET B;Direct Violet 62;5,5'-[Carbonylbis[imino(5-methoxy-2-sulfo-4,1-phenylene)azo]]bis[6-amino-4-hydroxy-2-naphthalenesulfonic acid]tetrasodium salt;C.I.25400;C.I.Direct Violet 62. CAS No. 7198-99-4. Molecular formula: C35H26N8Na4O17S4. Mole weight: 1050.84. | |
SIRIUS YELLOW GC Quick inquiry Where to buy Suppliers range | SIRIUS YELLOW GC. Group: Direct Dyes. Alternative Names: SIRIUS YELLOW GC;DIRECT YELLOW 44;DIRECT FAST YELLOW GC; abcoldirectyellow4gl; siriusyellow; Direct Yellow 5 GLL;HELION YELLOW G;Direct yellow 44 (C.I. 29000). CAS No. 8005-52-5. Molecular formula: C27H20N6Na2O8S. Mole weight: 634.53. | |
siRNA Electroporation Buffer (30 ml) Quick inquiry Where to buy Suppliers range | Electroporation buffer optimized for high transfection efficacy of siRNA, miRNA, and mRNA into primary cultures and hard-to-transfect cell lines. Uses: Electroporation of DNA, RNA, protein and small molecules. Product ID: 4066. | Nevada, Texas, USA |
SiRNA Negative Control Quick inquiry Where to buy Suppliers range | siRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. It is recommended as a negative control for evaluating RNAi off-target effects, and in order to verify the accuracy of gene specific siRNA dependent RNAi. Synonyms: RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA). Mole weight: 13323 ( AS: 6586.9; SS: 6736.1 ). | |
Sirodesmin A Quick inquiry Where to buy Suppliers range | Sirodesmin A is a diketopiperazine antibiotic isolated from the culture broth of Microsphaeropsis sp. FL-16144. TAN-1496 inhibited the relaxation of supercoiled pBR322 DNA by calf thymus topoisomerase I but did not affect the decatenation of kinetoplast DNA by calf thymus topoisomerase II at concentration up to 500 microM. Synonyms: TAN-1496B; TAN 1496B. CAS No. 52988-50-8. Molecular formula: C20H26N2O8S2. Mole weight: 486.6. | |
Sirodesmin B Quick inquiry Where to buy Suppliers range | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Synonyms: Spiro[furan-2 (3H), 9' (10'H)-[5, 11a] (iminomethano)[11aH]cyclopenta[4, 5]pyrrolo[2, 1-e][1, 2, 3, 4, 6]tetrathiazocine]-3, 6', 12' (5'H)-trione, 10'-(acetyloxy)-4,5,7'a,8',10'a,11'-hexahydro-10'ahydroxy-5'-(hydroxymethyl)-4,4,5,13'-tetramethyl-, (2R,5'R,7'aR,10'S,10'aS,11aR)-. CAS No. 52988-51-9. Molecular formula: C20H26N2O8S4. Mole weight: 550.69. | |
Sirodesmin C Quick inquiry Where to buy Suppliers range | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Synonyms: Spiro[furan-2 (3H), 8' (9'H)-[4, 10a] (iminomethano)[10aH]cyclopenta[4, 5]pyrrolo[2, 1-d][1, 2, 3, 5]trithiazepine]-3, 5', 11' (4'H)-trione, 9'-(acetyloxy)hexahydro-9'a-hydroxy-4'-(hydroxymethyl)-4,4,5,12'-tetramethyl-, (2R,4'R,5R,6'aR,9'S,9'aS,10aR)-. CAS No. 52988-52-0. Molecular formula: C20H26N2O8S3. Mole weight: 518.62. | |
Sirodesmin G Quick inquiry Where to buy Suppliers range | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. CAS No. 64599-26-4. Molecular formula: C20H26N2O8S2. Mole weight: 486.56. | |
Sirolimus Liposome Quick inquiry Where to buy Suppliers range | Sirolimus, a metabolite of Streptomyces hygroscopicus AYBP44, is not only a low-toxicity antifungal antibiotic but also a novel immunosuppressant. This product is a pre-formulated liposome with sirolimus. It is only for research purposes. Group: Drug-loaded liposome. | |
Sirpiglenastat Quick inquiry Where to buy Suppliers range | Sirpiglenastat is a glutaminase inhibitor. Synonyms: sirpiglenastatum; DRP-104; DRP104. Grades: >98%. CAS No. 2079939-05-0. Molecular formula: C22H27N5O5. Mole weight: 441.5. | |
SirReal 2 Quick inquiry Where to buy Suppliers range | SirReal 2. Group: Biochemicals. Grades: Purified. CAS No. 709002-46-0. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
SirReal2 Quick inquiry Where to buy Suppliers range | SirReal2 selectively targets SIRT2 and decreases migration as well as invasion in human GC cells. Synonyms: SirReal 2. Grades: 98%. CAS No. 709002-46-0. Molecular formula: C22H20N4OS2. Mole weight: 420.55. | |
SirReal2 Quick inquiry Where to buy Suppliers range | ≥98% (HPLC). Uses: For analytical and research use. Group: Fluorescence/Luminescence Spectroscopy. CAS No. 709002-46-0. Pack Sizes: 5MG, 25MG. Mole weight: 420.55. Catalog: AP709002460. Assay: ≥98% (HPLC). | |
SIRT1/2/3 pan Inhibitor (pan SIRT1/2/3 Inhibitor, 4- (4- (2-Pivalamidoethyl) piperidin-1-yl) thieno[3, 2-d]pyrimidine-6-carboxamide) Quick inquiry Where to buy Suppliers range | A thienopyrimidinyl carboxamide that acts as a highly potent, reversible pan sirtuin (SIRT) inhibitor (IC50 = 15, 10, and 33nM for SIRT1, 2, and 3, respectively). Shown to bind to the SIRT catalytic site and occupy both the nicotinamide C-pocket and acetyl lysine substrate channel. Exhibits high selectivity over a panel of protein kinases, nuclelar receptors, GPCRs, and ion-channels (IC50 > 10uM). Poorly affects hERG and cytochrome P450s (> 50uM). Exhibits desirable stability in microsomal preparations (human CLint = 15.8 uL/min/mg, mouse CLint = 12.7uL/min/mg) and high solubility (297uM), and low LogD (2.73). Group: Biochemicals. Grades: Highly Purified. Pack Sizes: 10mg. Molecular Formula: C??H??N?O?S. US Biological Life Sciences. | Worldwide |
SIRT1/2 Inhibitor VIII, Salermide - CAS 1105698-15-4 Quick inquiry Where to buy Suppliers range | The SIRT1/2 Inhibitor VIII, Salermide, also referenced under CAS 1105698-15-4, controls the biological activity of SIRT1/2. This small molecule/inhibitor is primarily used for Cell Structure applications. Uses: For analytical and research use. Group: Fluorescence/Luminescence Spectroscopy. CAS No. 1105698-15-4. Pack Sizes: 10MG. Mole weight: 394.47. Catalog: AP1105698154-B. Assay: ≥95% (HPLC). | |
SIRT1 Activator II (3- (Benzenesulfonyl) -1- (4-fluorophenyl) pyrrolo[4, 5-b]quinoxalin-2-amine) Quick inquiry Where to buy Suppliers range | A cell-permeable pyrroloquinoxaline compound that acts as a reversible SIRT1 activator (10uM causes ~2.3-fold fluorescent enhancement in a fluorescent assay using hrSIRT1) and enhances fat mobilization in fully differentiated 3T3L1 fibroblasts. Shown to inhibit LPS-induced TNF-a release in THP-1 cells by ~10-fold more potent than resveratrol. Group: Biochemicals. Grades: Highly Purified. CAS No. 374922-43-7. Pack Sizes: 10mg. Molecular Formula: C??H??FN?O?S, Molecular Weight: 418.4. US Biological Life Sciences. | Worldwide |
SIRT1 Inhibitor III Quick inquiry Where to buy Suppliers range | The SIRT1 Inhibitor III, also referenced under CAS 49843-98-3, controls the biological activity of SIRT1. This small molecule/inhibitor is primarily used for Cell Structure applications. Uses: For analytical and research use. Group: Fluorescence/Luminescence Spectroscopy. CAS No. 49843-98-3. Pack Sizes: 5MG. Mole weight: 248.71. Catalog: AP49843983-B. Assay: ≥95% (HPLC). | |
Sirt1 Inhibitor VII, Inauhzin Quick inquiry Where to buy Suppliers range | The Sirt1 Inhibitor VII, Inauhzin controls the biological activity of Sirt1. This small molecule/inhibitor is primarily used for Cell Structure applications. Uses: For analytical and research use. Group: Fluorescence/Luminescence Spectroscopy. Pack Sizes: 10MG. Mole weight: 469.58. Catalog: IAR42415467. Assay: ≥98% (HPLC). | |
SIRT2 Inhibitor (3-(1-azepanylsulfonyl)-N-(3-bromphenyl)benzamide) Quick inquiry Where to buy Suppliers range | Brain-permeable. A potent and selective sirtuin 2 deacetylase (SIRT2) inhibitor. Reduces neuronal cholesterol by inhibiting SIRT2 activity. Group: Biochemicals. Grades: Highly Purified. CAS No. 420831-40-9. Pack Sizes: 5mg, 25mg. US Biological Life Sciences. | Worldwide |
Sirtinol Quick inquiry Where to buy Suppliers range | Sirtinol is a known inhibitor of the NAD+-Dependent Protein Desuccinylase and Demalonylase Sirt5 and exhibits anticancer properties. Group: Biochemicals. Alternative Names: 2-[[ (2-hydroxy-1-naphthalenyl) methylene]amino]-N- (1-phenylethyl) -benzamide; Sir Two Inhibitor Naphthol. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 10mg, 25mg. US Biological Life Sciences. | Worldwide |
Sirtinol Quick inquiry Where to buy Suppliers range | Sirtinol is a SIRT inhibitor. Sirtinol significantly increased the acetylation of p53, which has been reported to be a target of SIRT1/2. Sirtinol significantly increased the G1 phase of the cell cycle. Synonyms: 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide; 2-{[(2-hydroxy-1-naphthyl)methylene]amino}-N-(1-phenylethyl)benzamide; 2-[(2-hydroxynaphthalen-1-yl)methylideneamino]-N-(1-phenylethyl)benzamide; Sir Two Inhibitor Naphthol; (E)-2-((2-hydroxynaphthalen-1-yl)methyleneamino)-N-(1-phenylethyl)benzamide; 2-(((2-Hydroxynaphthalen-1-yl)methylene)amino)-N-(1-phenylethyl)benzamide; 2-[[(2-Hydroxy-1-naphthalenyl)methylene]amino]- N -(1-phenylethyl)benzamide; (E)-2-(((2-HYDROXYNAPHTHALEN-1-YL)METHYLENE)AMINO)-N-(1-PHENYLETHYL)BENZAMIDE; {2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]}-N-(1-phenethyl)benzamide (Sirtinol. Grades: 0.98. CAS No. 410536-97-9. Molecular formula: C26H22N2O2. Mole weight: 394.474. | |
Sirtinol - CAS 410536-97-9 Quick inquiry Where to buy Suppliers range | A cell-permeable 2-hydroxy-1-naphthaldehyde derivative that acts as a specific and direct inhibitor of the sirtuin class of deacetylase activity with no affect on human HDAC1. Uses: For analytical and research use. Group: Fluorescence/Luminescence Spectroscopy. CAS No. 410536-97-9. Pack Sizes: 5MG. Mole weight: 394.47. Catalog: AP410536979. Assay: ≥97% (HPLC). | |
Sirtinol (SIRT2 Inhibitor Naphthol) Quick inquiry Where to buy Suppliers range | Cell-permeable. A selective sirtuin deacetylase inhibitor with IC50 values of 38, 68 and 131uM for SIRT2, Sir2p and SIRT1 respectively. Sirtinol has no effect on HDAC1 activity. Sirtinol inhibits the growth of cancer cells and suppresses inflammatory signaling in human dermal microvascular endothelial cells. Group: Biochemicals. Alternative Names: 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 5mg. US Biological Life Sciences. | Worldwide |
Sirtinol (Sir Two Inhibitor Naphthol, 2-N-(1-phenethyl)benzamide) Quick inquiry Where to buy Suppliers range | Specific cell permeable SIRT1 (sirtuin-1) inhibitor. Senescence-like growth arrest inducer. Platelet aggregation inhibitor. Apoptosis inducer. Group: Biochemicals. Alternative Names: Sir Two Inhibitor Naphthol, 2--N-(1-phenethyl)benzamide. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 1mg, 5mg, 25mg. Molecular Formula: C??H??N?O?. US Biological Life Sciences. | Worldwide |
Sirtuin-3 Inhibitor, SRT1720 (SIRT3 Inhibitor II, N- (2- (3- (1-Piperazinylmethyl) imidazo[2, 1-b]thiazol-6-yl) phenyl) -2-quinolinecarboxamide) Quick inquiry Where to buy Suppliers range | A cell-permeable quinolinecarboxamide compound that is shown to inhibit the mitochondrial SIRT3 in a substrate AceCS2-competitive (Ki = 0.56uM; Km = 2.44uM), but NAD+-uncompetitive (Ki = 0.34uM; Km = 280uM), manner. Also reported to decrease cellular p53 Lys382 acetylation (Effective conc. = 10uM in U2OS and MEF cultures) and inhibit p300 HAT activity (IC50 = 9uM) in vitro, as well as offer therapeutic benefits in several murine and rodent type 2 diabetes models (100mg/kg/dayl p.o.) in vivo. Whether and how SRT1720 activates SIRT1 activity remains uncertain. Group: Biochemicals. Grades: Highly Purified. CAS No. 925434-55-5. Pack Sizes: 10mg. US Biological Life Sciences. | Worldwide |
Sis3 Quick inquiry Where to buy Suppliers range | Sis3. Group: Heterocyclic Organic Compound. Alternative Names: SIS3 hydrochloride, AGN-PC-00SMAM, SureCN6488325, CTK8E8838, 521984-48-5, (E)-1-(6,7-dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl)-3-(1-methyl-2-phenylpyrrolo[2,3-b]pyridin-3-yl)prop-2-en-1-one;hydrochloride. Grades: ≥98%. CAS No. 521984-48-5. Product ID: ACM521984485. Molecular formula: C28H27N3O3HCl. Mole weight: 489.99. IUPAC Name: 1-(6,7-dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl)-3-(1-methyl-2-phenylpyrrolo[2,3-b]pyridin-3-yl)prop-2-en-1-one;hydrochloride. Boiling Point: 737.2ºC at 760 mmHg. Flash Point: 399.7ºC. | |
SIS3 Quick inquiry Where to buy Suppliers range | SIS3. Group: Biochemicals. Grades: Purified. CAS No. 521984-48-5. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
SIS3 HCl Quick inquiry Where to buy Suppliers range | SIS3 is a potent and specific inhibitor of Smad3 via inhibiting the effects of TGF-β1. SIS3 inhibits TGF-β and activin signaling by suppressing Smad3 phosphorylation with no effect on Smad2, p38 MAPK, ERK or PI 3-kinase signaling. It inhibits TGF-β1-induced myofibroblast differentiation of dermal fibroblasts. Synonyms: (2E)-1-(6,7-Dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl)-3-(1-methyl-2-phenyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-propenone hydrochloride. Grades: >98%. CAS No. 521984-48-5. Molecular formula: C28H27N3O3.HCl. Mole weight: 489.99. | |
Sisomicin Quick inquiry Where to buy Suppliers range | Antibacterial. Gentamicin-like aminoglycoside antibiotic; has broad spectrum antibiotic activity. Group: Biochemicals. Alternative Names: O-3-Deoxy-4-C-methyl-3-(methylamino)- β-L-arabinopyranosyl-(1-6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hex-4-enopyranosyl-(1-4)]-2-deoxy- D-Streptamine; Antibiotic 66-40; Antibiotic 6640; Rickamicin; Sch 13475; Siseptin. Grades: Highly Purified. CAS No. 32385-11-8. Pack Sizes: 1g. US Biological Life Sciences. | Worldwide |
Sisomicin Quick inquiry Where to buy Suppliers range | It is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis NRRL 3292. It has a broad-spectrum antibacterial effects against Gram-positive and Gram-negative bacteria including B. subtilis, S. aureus, E. coli, and P. aeruginosa. It has no cross-resistance to kanamycin, but has cross-resistance to gentamycin. 50 mg/kg of Sisomicin has protective effect on mice infected with Rickettsia spinosa. Uses: Protein synthesis inhibitors. Synonyms: D-Streptamine, O-3-deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl-(1?6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hex-4-enopyranosyl-(1?4)]-2-deoxy-; Antibiotic 6640; SCH 13475; Rickamicin; Sisomycin; Sissomicin; O-3-Deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl-(1?6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hex-4-enopyranosyl-(1?4)]-2-deoxy-D-streptamine; Antibiotic 66-40; BactoCeaze; Ensamycin; Sch 13475; Siseptin. Grades: ≥98%. CAS No. 32385-11-8. Molecular formula: C19H37N5O7. Mole weight: 447.53. | |
Sisomicin B Quick inquiry Where to buy Suppliers range | It is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis. It has broad-spectrum antimicrobial activity. Synonyms: Sisomicin B; 6-O-[3-Deoxy-3-(methylamino)-α-D-xylopyranosyl]-4-O-(2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hexa-4-enopyranosyl)-2-deoxy-D-streptamine; Antibiotic 66-40B; 6640B; D-Streptamine, O-3-deoxy-3-(methylamino)-alpha-D-xylopyranosyl-(1-6)-o-(2,6-diamino-2,3,4,6-tetradeoxy-alpha-D-glycero-hex-4-enopyranosyl-(1-4))-2-deoxy-. CAS No. 53797-16-3. Molecular formula: C18H35N5O7. Mole weight: 433.50. | |
Sisomicin D Quick inquiry Where to buy Suppliers range | It is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis. It has broad-spectrum antimicrobial activity. Synonyms: 6-O-[3-Deoxy-3-(methylamino)-β-L-arabinopyranosyl]-4-O-(2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hexa-4-enopyranosyl)-2-deoxy-D-streptamine; Antibiotic 66-40D; 66-40D. CAS No. 53759-50-5. Molecular formula: C18H35N5O7. Mole weight: 433.50. | |
Sisomicin sulfate Quick inquiry Where to buy Suppliers range | United States Pharmacopeia (USP) Reference Standard. Uses: For analytical and research use. Group: Pharmacopeia & Metrological Institutes Standards; API Standards; European Pharmacopoeia (Ph. Eur.); Pharmaceutical Toxicology; Pharmacopoeial Standards. Alternative Names: Mensiso,Antibiotic 66-40 sulfate, D-Streptamine, O-3-deoxy-4-C-methyl-3-(methylamino)-beta-L-arabinopyranosyl-(1?6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-alpha-D-glycero-hex-4-enopyranosyl-(1?4)]-2-deoxy-, sulfate (2:5), Sisolline, Sisomin, D-Streptamine, O-3-deoxy-4-C-methyl-3-(methylamino)-beta-L-arabinopyranosyl-(1?6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-alpha-D-glycero-hex-4-enopyranosyl-(1?4)]-2-deoxy-, sulfate (2:5) (salt) (9CI), Sisobiotic, Sisomicin sulfate, Baymicin, Sisomycin sulfate, Extramycin, Sissomicin sulfate. CAS No. 53179-09-2. Pack Sizes: 500MG. IUPAC Name: (2R,3R,4R,5R)-2-[(1S,2S,3R,4S,6R)-4,6-diamino-3-[[(2S,3R)-3-amino-6-(aminomethyl)-3,4-dihydro-2H-pyran-2-yl]oxy]-2-hydroxycyclohexyl]oxy-5-methyl-4-(methylamino)oxane-3,5-diol;sulfuric acid. Molecular formula: 2C19H37N5O7.5H2O4S. Mole weight: 1385.45. Catalog: APS53179092. SMILES: CN[C@@H]1[C@@H] (O)[C@@H] (O[C@H]2[C@H] (N)C[C@H] (N)[C@@H] (O[C@H]3OC (=CC[C@H]3N)CN)[C@@H]2O)OC[C@]1 (C)O. CN[C@@H]4[C@@H] (O)[C@@H] (O[C@H]5[C@H] (N)C[C@H] (N)[C@@H] (O[C@H]6OC (=CC[C@H]6N)CN)[C@@H]5O)OC[C@]4 (C)O. OS (=O) (=O)O. OS (=O) (=O)O. OS (=O) (=O)O. OS (=O) (=O)O. OS (=O) (=O)O. Format: Neat. Product Type: API. | |
Sisomicin sulfate Quick inquiry Where to buy Suppliers range | Sisomicin sulfate. Group: Biochemicals. Grades: Highly Purified. CAS No. 53179-09-2. Pack Sizes: 250mg, 500mg, 1g, 2g, 5g. Molecular Formula: 2C19H37N5O7·5H2SO4. US Biological Life Sciences. | Worldwide |
Sisomicin Sulfate Quick inquiry Where to buy Suppliers range | Sisomicin Sulfate is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis NRRL 3292. It has a broad-spectrum antibacterial effects against Gram-positive and Gram-negative bacteria. Uses: Protein synthesis inhibitors. Synonyms: D-Streptamine, 4-O-[(2S,3R)-3-amino-6-(aminomethyl-3,4-dihydro-2H-pyran-2-y1]-2-deoxy-6-O-[3-deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl]-, sulfate (salt); D-Streptamine, 4-O-[3-amino-6-(aminomethyl-3,4-dihydro-2H-pyran-2-y1]-2-deoxy-6-O-[3-deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl]-, (2S-cis)-, sulfate (salt). Grades: ≥95%. CAS No. 53776-71-9. Molecular formula: C19H37N5O7.xH2O4S. Mole weight: 447.52 (free base). | |
S-isopropyl 3-methylthiobutyrate Quick inquiry Where to buy Suppliers range | S-isopropyl 3-methylthiobutyrate. Group: Low Molecular Weight Esters. Alternative Names: Butanethioic acid, 3-methyl-, S-(1-methylethyl) ester. CAS No. 34322-06-0. Molecular Weight: 160.28. Molecular Formula: C8H16OS. Purity: 96%. | |
S-Isopropylisothiourea hydrobromide Quick inquiry Where to buy Suppliers range | S-Isopropylisothiourea hydrobromide. Group: Biochemicals. Grades: Purified. CAS No. 4269-97-0. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |