A directory of where to buy chemicals in the USA, including: distributors, industrial manufacturers, bulk supplies and wholesalers of raw ingredients & finished goods.
Search for products or services, then visit the suppliers website for prices or more information.
| Product | Description | |
|---|---|---|
| Sinomenine | Sinomenine. Group: Biochemicals. Grades: Highly Purified. CAS No. 115-53-7. Pack Sizes: 100mg, 250mg, 500mg, 1g, 2g. US Biological Life Sciences. |  Worldwide |
| Sinomenine | Sinomenine, an alkaloid extracted from Sinomenium acutum , is a blocker of the NF-κB activation [1]. Sinomenine also is an activator of μ-opioid receptor [2]. Uses: Scientific research. Group: Natural products. CAS No. 115-53-7. Pack Sizes: 10 mM * 1 mL; 100 mg. Product ID: HY-15122. |  |
| Sinomenine Extract (Ratio) | Sinomenine Extract (Ratio). Group: Others. Purity: 4:1~20:1. Sinomenine Extract (Ratio). Cat No: EXTW-060. |  |
| Sinomenine hydrochloride | Sinomenine hydrochloride (Cucoline hydrochloride), an alkaloid extracted from Sinomenium acutum , is a blocker of the NF-κB activation [1]. Sinomenine also is an activator of μ-opioid receptor [2]. Uses: Scientific research. Group: Natural products. Alternative Names: Cucoline hydrochloride. CAS No. 6080-33-7. Pack Sizes: 10 mM * 1 mL; 100 mg. Product ID: HY-15122A. | |
| Sinomenine Hydrochloride | Sinomenine is an optical isomer of Methoxythebainone. Sinomenine was extracted from root of Sinomenium acutum. Sinomenine has anti-inflammatory and analgesic effect. Group: Biochemicals. Alternative Names: (9α, 13α, 14α)-7, 8-Didehydro-4-hydroxy-3, 7-dimethoxy-17-methylmorphinan-6-one Hydrochloride; 7, 8-Didehydro-4-hydroxy-3, 7-dimethoxy-17-methyl-9α, 13α, 14α-morphinan-6-one Hydrochloride; (9α, 13α, 14α)- 7,8-Didehydro-4-hydroxy-3,7-dimethoxy-17-methylmorphinan-6-one Hydrochloride; Cucoline Hydrochloride; NSC 76021; Sinomenin Hydrochloride. Grades: Highly Purified. CAS No. 6080-33-7. Pack Sizes: 1mg. US Biological Life Sciences. | Worldwide |
| Sinorphan | Sinorphan. Group: Biochemicals. Alternative Names: N-[(2S)-2-[(Acetylthio)methyl]-1-oxo-3-phenylpropyl]glycine Phenylmethyl Ester; BAY-y 7432; BP 1.02; Ecadotril; S 049. Grades: Highly Purified. CAS No. 112573-73-6. Pack Sizes: 2.5mg. Molecular Formula: C21H23NO4S, Molecular Weight: 385.48. US Biological Life Sciences. | Worldwide |
| Sinorphan-d5 | Sinorphan-d5. Group: Biochemicals. Alternative Names: N-[(2S)-2-[(Acetylthio)methyl]-1-oxo-3-phenylpropyl]glycine Phenylmethyl Ester-d5; BAY-y 7432-d5; BP 1.02-d5; Ecadotril; S 049-d5. Grades: Highly Purified. Pack Sizes: 2.5mg. Molecular Formula: C21H18D5NO4S, Molecular Weight: 390.51. US Biological Life Sciences. | Worldwide |
| SiNP | SiNP. Group: Elements nanoparticles. |  |
| S in-situ doped Ti3AlC2 MAX | This is an in situ sulfur doping strategy that functionalizes MXene nanosheets by introducing heteroatomic sulfur from the MAX precursor into the MXene structure. Three-dimensional folded MXene nanostructures with high specific surface areas were prepared by vacuum freeze-drying. Uses: Energy storage, catalysis, analytical chemistry, mechanics, adsorption, biology, microelectronics, sensors, etc. Group: Mxenes materials. CAS No. 196506-01-1. 0.99. | |
| S in-situ doped Ti3C2 MXene | Organ-like material, obtained by etching with hydrofluoric acid. Uses: Energy storage, catalysis, analytical chemistry, mechanics, adsorption, biology, microelectronics, sensors, etc. Group: Mxenes materials. CAS No. 12363-89-2. 0.99. | |
| Sintilimab | Sintilimab (IBI308) is a safe and effectivel humanized IgG4 monoclonal antibody that binds to PD-1 with a K D value of 74 pM. Sintilimab blocks the interaction of PD-1 with its ligands (PD-L1 and PL-L2), consequently helping to restore the endogenous antitumour T-cell response. Sintilimab combined with prebiotics inhibits tumor volume and regulates immune cell subpopulation balance in lung adenocarcinoma mice. Sintilimab can be used for the research of classical Hodgkin's lymphoma, non-small cell lung cancer and oesophageal cancer [1] [2] [3] [4] [5]. Uses: Scientific research. Group: Inhibitory antibodies. Alternative Names: IBI308. CAS No. 2072873-06-2. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99048. | |
| Sintilimab | Sintilimab is a human monoclonal antibody that targets PD-1 and blocks the interaction with its ligands. Sintilimab has been approved for the treatment of Hodgkin's lymphoma. Synonyms: IBI308. CAS No. 2072873-06-2. |  |
| SiO2 Au Core Shell Nanoparticles | SiO2 Au Core Shell Nanoparticles. Group: Core shell nanoparticles. 99.9%. | |
| SiO2 coated Upconverting Nanoparticles(green light) | SiO2 coated Upconverting Nanoparticles(green light). Uses: Up conversion nanoparticles have excellent optical stability. they have been widely applied in biomedicine, including in vivo bioimaging, in vivo bioimaging, biodetection, immunohistochemistry, microarray detection, photodynamic therapy, and photoactivated drug activation. Group: Sio2 coated upconverting nanoparticles. Pack Sizes: 10 mg/20 mg/50 mg. | |
| SiO2 coated upconverting nanoparticles(near-infrared light) | SiO2 coated upconverting nanoparticles(near-infrared light). Uses: Up conversion noparticles have excellent optical stability. they have been widely applied in biomedicine, including in vivo bioimaging, in vivo bioimaging, biodetection, immunohistochemistry, microarray detection, photodymic therapy, and photoactivated drug activation. Group: Sio2 coated upconverting nanoparticles. Pack Sizes: 50 mg. | |
| SiO2 coated Upconverting Nanoparticles(Purple and blue light) | SiO2 coated Upconverting Nanoparticles(Purple and blue light). Uses: Up conversion nanoparticles have excellent optical stability. they have been widely applied in biomedicine, including in vivo bioimaging, in vivo bioimaging, biodetection, immunohistochemistry, microarray detection, photodynamic therapy, and photoactivated drug activation. Group: Sio2 coated upconverting nanoparticles. Pack Sizes: 10 mg/20 mg/50 mg. | |
| SiO2 coated Upconverting Nanoparticles(UV light) | SiO2 coated Upconverting Nanoparticles(UV light). Uses: Up conversion nanoparticles have excellent optical stability. they have been widely applied in biomedicine, including in vivo bioimaging, in vivo bioimaging, biodetection, immunohistochemistry, microarray detection, photodynamic therapy, and photoactivated drug activation. Group: Sio2 coated upconverting nanoparticles. Pack Sizes: 10 mg/20 mg/50 mg. | |
| SiO2 coated Upconverting Nanoparticles(yellow-green light) | SiO2 coated Upconverting Nanoparticles(yellow-green light). Uses: Up conversion nanoparticles have excellent optical stability. they have been widely applied in biomedicine, including in vivo bioimaging, in vivo bioimaging, biodetection, immunohistochemistry, microarray detection, photodynamic therapy, and photoactivated drug activation. Group: Sio2 coated upconverting nanoparticles. Pack Sizes: 10 mg/20 mg/50 mg. | |
| SiO2-COOH modified upconverting nanoparticles (near-infrared light) | SiO2-COOH modified upconverting nanoparticles (near-infrared light). Group: Graphene quantum dots. | |
| SiO2-COOH modified upconverting nanoparticles (purple-blue light) | SiO2-COOH modified upconverting nanoparticles (purple-blue light). Group: Graphene quantum dots. | |
| SiO2-COOH modified upconverting nanoparticles (Yellow green light) | SiO2-COOH modified upconverting nanoparticles (Yellow green light). Group: Graphene quantum dots. | |
| SiO2 NanoFibers | SiO2 NanoFibers. Group: Nanofibers. | |
| SiO2 nanopowder | SiO2 nanopowder. Group: Compounds nanoparticles. 99%. | |
| SiO2 Nanopowder | SiO2 Nanopowder. Group: Oxides nanoparticles. CAS No. 7631-86-9. Molecular formula: 60.08 g/mol. Mole weight: SiO2. 99.9%. | |
| SiO2 Nanospheres | SiO2 Nanospheres. Group: Oxides nanoparticles. CAS No. 7631-86-9. Molecular formula: 60.08 g/mol. Mole weight: SiO2. 99.9%. | |
| SiO2-NH2 modified upconverting nanoparticles(Purple-blue light) | SiO2-NH2 modified upconverting nanoparticles(Purple-blue light). Group: Graphene quantum dots. | |
| Siomycin | Siomycin is a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G and aminoacyl-tRNA. It exhibits antitumor activity against certain cancer cell lines. CAS No. 11017-43-9. Molecular formula: C64H88N16O22S4. Mole weight: 1561.73. | |
| Siomycin A | A macrocyclic antibiotic first isolated from S. sioyaensis with potent and selective antibacterial activity. It is a potent inhibitor of the oncogenic transcription factor, foxm1. It inhibits foxm1-induced cell growth on soft agar and selectively kills transformed but not normal cells in vitro. Synonyms: Mutabilycin; Sporangiomycin; 6741-21; NSC 285116; Antibiotic 6741-21; (1-L-valine)-[2-(2,3-didehydro-alanine)]-thiostrepton; Thiostrepton, 1-Valine-2-(2,3-didehydroalanine)-. Grades: >95% by HPLC. CAS No. 12656-09-6. Molecular formula: C71H81N19O18S5. Mole weight: 1648.84. | |
| Siomycin A (Mutabilycin, Sporangiomycin, Antibiotic 6741-21, Mutabillicin) | Siomycin A (Mutabilycin, Sporangiomycin, Antibiotic 6741-21, Mutabillicin). Group: Biochemicals. Alternative Names: Mutabilycin, Sporangiomycin, Antibiotic 6741-21, Mutabillicin. Grades: Highly Purified. CAS No. 12656-09-6. Pack Sizes: 500ug. US Biological Life Sciences. | Worldwide |
| Sipatrigine | Sipatrigine. Group: Biochemicals. Grades: Purified. CAS No. 130800-90-7. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
| Sipatrigine | Sipatrigine is a blocker of voltage-dependent sodium channels (NaV) and a glutamate release inhibitor. Sipatrigine exhibits neuroprotective activity in rat models of cerebral ischemia. It was also reported to block Ca2+ channels. Uses: Neuroprotective agents. Synonyms: 619C; 619C-89; BW-619C-89; BW-619C89; 619 C; 619C 89; BW 619C-89; BW 619C89; 619C; 619C89; BW619C89; 2-(4-Methyl-1-piperazinyl)-5-(2,3,5-trichlorophenyl)-4-pyrimidinamine. Grades: ≥99% by HPLC. CAS No. 130800-90-7. Molecular formula: C15H16Cl3N5. Mole weight: 372.68. | |
| Sipatrigine | Sipatrigine (619C89), a neuroprotective agent, is a glutamate release inhibitor, voltage-dependent sodium channel and calcium channel inhibitor, penetrating the central nervous system. Has the potential in the study for focal cerebral ischemia and stroke [1] [2]. Uses: Scientific research. Group: Signaling pathways. Alternative Names: 619C89; BW 619C89. CAS No. 130800-90-7. Pack Sizes: 10 mM * 1 mL; 5 mg. Product ID: HY-108335. | |
| Sipavibart | Sipavibart is an anti- SARS-CoV-2 human IgG1 λ2 monoclonal antibody [1]. Recommend Isotype Controls: Human IgG1 lambda2, Isotype Control (HY-P990096). Uses: Scientific research. Group: Inhibitory antibodies. Alternative Names: AZD3152. CAS No. 2768288-97-5. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P990766. | |
| Sipeimine (Imperialine) | Sipeimine (Imperialine). Group: Biochemicals. Alternative Names: Sipeimine; Kashmirine. Grades: Plant Grade. CAS No. 61825-98-7. Pack Sizes: 20mg. Molecular Formula: C27H43NO3, Molecular Weight: 429.634999999999. US Biological Life Sciences. | Worldwide |
| Siplizumab | Siplizumab (MEDI-507) is a humanized IgG1 monoclonal antibody against CD2. Siplizumab depletes T cells, decreases T cell activation, inhibites T cell proliferation and enriches naïve and bona fide regulatory T cells [1]. Uses: Scientific research. Group: Inhibitory antibodies. Alternative Names: MEDI-507. CAS No. 288392-69-8. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99904. | |
| Siponimod | Siponimod. Uses: For analytical and research use. Group: Impurity standards. CAS No. 1230487-00-9. Molecular Formula: C29H35F3N2O3. Mole Weight: 516.61. Catalog: APB1230487009. |  |
| Siponimod | Siponimod (BAF-312) is an orally active and selective sphingosine-1-phosphate ( S1P ) receptor modulator. Siponimod is selective for S1P 1 and S1P 5 over S1P 2 , S1P 3 , and S1P 4 , with EC 50 s of 0.4, 0.98, >10000, >1000, and 750 nM, respectively. Siponimod can be used for multiple sclerosis (MS) research [1] - [4]. Uses: Scientific research. Group: Signaling pathways. Alternative Names: BAF-312. CAS No. 1230487-00-9. Pack Sizes: 10 mM * 1 mL; 5 mg; 10 mg; 50 mg; 100 mg; 500 mg; 1 g. Product ID: HY-12355. | |
| Siponimod | Siponimod is a selective S1P1 and S1P5 agonist with EC50 of 0.39 nM and 0.98 nM, respectively. It has been approved by US FDA for the treatment of patients with active secondary progressive multiple sclerosis (SPMS). Synonyms: BAF-312; BAF 312; BAF312; Siponimod; Mayzent; 1-[[4-[(E)-N-[[4-cyclohexyl-3-(trifluoromethyl)phenyl]methoxy]-C-methylcarbonimidoyl]-2-ethylphenyl]methyl]azetidine-3-carboxylic acid. Grades: >98%. CAS No. 1230487-00-9. Molecular formula: C29H35F3N2O3. Mole weight: 516.6. | |
| Siponimod Impurity 10 | Siponimod Impurity 10. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C16H19F3O2. Mole Weight: 300.32. Catalog: APB10829. | |
| Siponimod Impurity 11 | Siponimod Impurity 11. Uses: For analytical and research use. Group: Impurity standards. CAS No. 1378888-43-7. Molecular Formula: C11H14O2. Mole Weight: 178.23. Catalog: APB1378888437. | |
| Siponimod Impurity 12 | Siponimod Impurity 12. Uses: For analytical and research use. Group: Impurity standards. CAS No. 800379-62-8. Molecular Formula: C14H18F3NO. Mole Weight: 273.3. Catalog: APB800379628. | |
| Siponimod Impurity 13 | Siponimod Impurity 13. Uses: For analytical and research use. Group: Impurity standards. CAS No. 2474774-17-7. Molecular Formula: C15H19NO3. Mole Weight: 261.32. Catalog: APB2474774177. | |
| Siponimod Impurity 14 | Siponimod Impurity 14. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C29H37F3N2O4. Mole Weight: 534.62. Catalog: APB10830. | |
| Siponimod Impurity 15 | Siponimod Impurity 15. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C29H35F3N2O3. Mole Weight: 516.61. Catalog: APB10831. | |
| Siponimod Impurity 8 | Siponimod Impurity 8. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C32H40N2O5. Mole Weight: 532.68. Catalog: APB10827. | |
| Siponimod Impurity 9 | Siponimod Impurity 9. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C32H40N2O5. Mole Weight: 532.68. Catalog: APB10828. | |
| Siraitia grosvenorii saponin V | Siraitia grosvenorii saponin V. Uses: For analytical and research use. Group: Impurity standards. CAS No. 88901-36-4. Molecular Formula: C60H102O29. Mole Weight: 1287.45. Catalog: APB88901364. | |
| Siramesine | Siramesine is a selective sigma-2 receptor agonist with a potent anticancer activity in vivo. It was originally devevloped for treating depressant and it has pro-apoptotic activity on various transformed cell types. Synonyms: 1'-[4-[1-(4-fluorophenyl)indol-3-yl]butyl]spiro[1H-2-benzofuran-3,4'-piperidine] 1-(4-fluorophenyl)-3-(4-(4-(4-fluorophenyl)-1-piperidinyl)-1-butyl)-1H-indole Lu 28-179 Lu-28-179 Siramesine. CAS No. 147817-50-3. Molecular formula: C30H31FN2O. Mole weight: 454.58. | |
| Siramesine fumarate | Siramesine is a sigma receptor agonist with selectivity for σ2 over σ1 (IC50 = 0.19 and 17 nM, respectively). It exhibits anxiolytic and antidepressant effects. Siramesine has been shown to trigger cell death of cancer cells and to exhibit a potent anticancer activity in vivo. Synonyms: Lu 28-179; Siramesine fumarate salt; 1'-[4-[1-(4-fluorophenyl)indol-3-yl]butyl]spiro[1H-2-benzofuran-3,4'-piperidine] fumarate. Grades: ≥98%. CAS No. 163630-79-3. Molecular formula: C30H31FN2O·C4H4O4. Mole weight: 570.7. | |
| Siramesine hydrochloride | Siramesine hydrochloride is the hydrochloride salt form of Siramesine. Siramesine is a selective sigma-2 receptor agonist with potent anticancer activity in vivo. It was originally devevloped for treating depressant. Synonyms: Siramesine (hydrochloride); Siramesine HCl; Lu-28-179; Lu 28-179; Lu28-179; Lu-28179; Lu 28179; Lu28179. CAS No. 224177-60-0. Molecular formula: C30H32ClFN2O. Mole weight: 491.04. | |
| Siremadlin | Siremadlin (NVP-HDM201) is a potent, orally bioavailable and highly specific p53-MDM2 interaction inhibitor. Uses: Scientific research. Group: Signaling pathways. Alternative Names: NVP-HDM201; HDM201. CAS No. 1448867-41-1. Pack Sizes: 10 mM * 1 mL; 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-18658. | |
| Sirexatamab | Sirexatamab is an active peptide. Sirexatamab can be used for various biochemical studies. Uses: Scientific research. Group: Inhibitory antibodies. CAS No. 2414962-49-3. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99906. | |
| Sirius orange g | Sirius orange g. Uses: Designed for use in research and industrial production. Additional or Alternative Names: EINECS 229-157-5, CID6454824, 6420-32-2, Tetrasodium 4,4-(carbonylbis(imino(5-methoxy-2-methyl-4,1-phenylene)azo))bis(naphthalene-2,6-disulphonate). Product Category: Heterocyclic Organic Compound. CAS No. 6420-32-2. Molecular formula: C37H28N6Na4O15S4. Mole weight: 1016.87. Purity: 0.96. IUPACName: tetrasodium 4-[[4-[[4-[(3,7-disulfonatonaphthalen-1-yl)diazenyl]-2-methoxy-5-methylphenyl]carbamoylamino]-5-methoxy-2-methylphenyl]diazenyl]naphthalene-2,6-disulfonate. Product ID: ACM6420322. Alfa Chemistry ISO 9001:2015 Certified. |  |
| Sirius Red ≥21% (Dye content) | Sirius Red ≥21% (Dye content). Group: Biochemicals. Grades: Reagent Grade. Pack Sizes: 25g, 100g, 250g. US Biological Life Sciences. | Worldwide |
| Sirius Red Powder C.I. 35780 | 25g Pack Size. Group: Analytical Reagents, Stains & Indicators. Formula: C45H32N10O21S6. CAS No. 2610-10-8. Prepack ID 90028587-25g. Molecular Weight 1373.05. See USA prepack pricing. |  |
| SIRIUS SUPRA RED VIOLET B | SIRIUS SUPRA RED VIOLET B. Uses: Designed for use in research and industrial production. Additional or Alternative Names: SIRIUS SUPRA RED VIOLET B;Direct Violet 62;5,5'-[Carbonylbis[imino(5-methoxy-2-sulfo-4,1-phenylene)azo]]bis[6-amino-4-hydroxy-2-naphthalenesulfonic acid]tetrasodium salt;C.I.25400;C.I.Direct Violet 62. Product Category: Direct Dyes. CAS No. 7198-99-4. Molecular formula: C35H26N8Na4O17S4. Mole weight: 1050.84. Product ID: ACM7198994. Alfa Chemistry ISO 9001:2015 Certified. | |
| SIRIUS YELLOW GC | SIRIUS YELLOW GC. Uses: Designed for use in research and industrial production. Additional or Alternative Names: SIRIUS YELLOW GC;DIRECT YELLOW 44;DIRECT FAST YELLOW GC;abcoldirectyellow4gl;siriusyellow;Direct Yellow 5 GLL;HELION YELLOW G;Direct yellow 44 (C.I. 29000). Product Category: Direct Dyes. CAS No. 8005-52-5. Molecular formula: C27H20N6Na2O8S. Mole weight: 634.53. Product ID: ACM8005525. Alfa Chemistry ISO 9001:2015 Certified. | |
| siRNA Electroporation Buffer (30 ml) | Electroporation buffer optimized for high transfection efficacy of siRNA, miRNA, and mRNA into primary cultures and hard-to-transfect cell lines. Uses: Electroporation of DNA, RNA, protein and small molecules. Product ID: 4066. |  Nevada, Texas, USA |
| SiRNA Negative Control | siRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. It is recommended as a negative control for evaluating RNAi off-target effects, and in order to verify the accuracy of gene specific siRNA dependent RNAi. Synonyms: RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA). Mole weight: 13323 ( AS: 6586.9; SS: 6736.1 ). | |
| Sirodesmin A | Sirodesmin A is a diketopiperazine antibiotic isolated from the culture broth of Microsphaeropsis sp. FL-16144. TAN-1496 inhibited the relaxation of supercoiled pBR322 DNA by calf thymus topoisomerase I but did not affect the decatenation of kinetoplast DNA by calf thymus topoisomerase II at concentration up to 500 microM. Synonyms: TAN-1496B; TAN 1496B. CAS No. 52988-50-8. Molecular formula: C20H26N2O8S2. Mole weight: 486.6. | |
| Sirodesmin B | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Synonyms: Spiro[furan-2 (3H), 9' (10'H)-[5, 11a] (iminomethano)[11aH]cyclopenta[4, 5]pyrrolo[2, 1-e][1, 2, 3, 4, 6]tetrathiazocine]-3, 6', 12' (5'H)-trione, 10'-(acetyloxy)-4,5,7'a,8',10'a,11'-hexahydro-10'ahydroxy-5'-(hydroxymethyl)-4,4,5,13'-tetramethyl-, (2R,5'R,7'aR,10'S,10'aS,11aR)-. CAS No. 52988-51-9. Molecular formula: C20H26N2O8S4. Mole weight: 550.69. | |
| Sirodesmin C | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Synonyms: Spiro[furan-2 (3H), 8' (9'H)-[4, 10a] (iminomethano)[10aH]cyclopenta[4, 5]pyrrolo[2, 1-d][1, 2, 3, 5]trithiazepine]-3, 5', 11' (4'H)-trione, 9'-(acetyloxy)hexahydro-9'a-hydroxy-4'-(hydroxymethyl)-4,4,5,12'-tetramethyl-, (2R,4'R,5R,6'aR,9'S,9'aS,10aR)-. CAS No. 52988-52-0. Molecular formula: C20H26N2O8S3. Mole weight: 518.62. | |
| Sirodesmin G | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. CAS No. 64599-26-4. Molecular formula: C20H26N2O8S2. Mole weight: 486.56. | |
| sirohydrochlorin cobaltochelatase | This enzyme is a type II chelatase, being either a monomer (CbiX) or a homodimer (CibK) and being ATP-independent. CbiK from Salmonella enterica uses precorrin-2 as the substrate to yield cobalt-precorrin-2. The enzyme contains two histidines at the active site that are thought to be involved in the deprotonation of the tetrapyrrole substrate as well as in metal binding. CbiX from Bacillus megaterium inserts cobalt at the level of sirohydrochlorin (factor-II) rather than precorrin-2. Group: Enzymes. Synonyms: CbiK; CbiX; CbiXS; anaerobic cobalt chelatase; cobaltochelatase [ambiguous]; sirohydrochlorin cobalt-lyase (incorrect). Enzyme Commission Number: EC 4.99.1.3. Storage: Store it at +4 ?C for short term. For long term storage, store it at -20 ?C?-80 ?C. Form: Liquid or lyophilized powder. EXWM-5360; sirohydrochlorin cobaltochelatase; EC 4.99.1.3; CbiK; CbiX; CbiXS; anaerobic cobalt chelatase; cobaltochelatase [ambiguous]; sirohydrochlorin cobalt-lyase (incorrect). Cat No: EXWM-5360. | |
| sirohydrochlorin ferrochelatase | This enzyme catalyses the third of three steps leading to the formation of siroheme from uroporphyrinogen III. The first step involves the donation of two S-adenosyl-L-methionine-derived methyl groups to carbons 2 and 7 of uroporphyrinogen III to form precorrin-2 (EC 2.1.1.107, uroporphyrin-III C-methyltransferase) and the second step involves an NAD+-dependent dehydrogenation to form sirohydrochlorin from precorrin-2 (EC 1.3.1.76, precorrin-2 dehydrogenase). In Saccharomyces cerevisiae, the last two steps are carried out by a single bifunctional enzyme, Met8p. In some bacteria, steps 1-3 are catalysed by a single multifunctional protein called CysG, whereas in Bacillus megaterium, three separate enzymes carry out each of the steps, with SirB being responsible for the above reaction. Group: Enzymes. Synonyms: CysG; Met8P; SirB; sirohydrochlorin ferro-lyase (incorrect). Enzyme Commission Number: EC 4.99.1.4. Storage: Store it at +4 ?C for short term. For long term storage, store it at -20 ?C?-80 ?C. Form: Liquid or lyophilized powder. EXWM-5361; sirohydrochlorin ferrochelatase; EC 4.99.1.4; CysG; Met8P; SirB; sirohydrochlorin ferro-lyase (incorrect). Cat No: EXWM-5361. | |
| Sirolimus isoform 2 | Sirolimus isoform 2. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C38H57NO11. Mole Weight: 703.87. Catalog: APB09601. | |
| Sirolimus isoform 3 | Sirolimus isoform 3. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C52H81NO13. Mole Weight: 928.21. Catalog: APB09600. | |
| Sirolimus Liposome | Sirolimus, a metabolite of AYBP44 (streptomyces hygroscopicus), is not only a low-toxicity antibiotic but also a novel immunosuppressant. This product is a pre-formulated liposome with sirolimus. It is only for research purposes. Group: Drug-loaded liposome. Categories: liposomes, niosomes, ethosomes, and transfersomes. |  |
| Sirolimus (Rapamycin) | Sirolimus, also known as rapamycin, is a natural macrocyclic lactone produced by the bacterium Streptomyces hygroscopicus, with immunosuppressant properties. In cells, sirolimus binds to the immunophilin FK Binding Protein-12 (FKBP-12) to generate an immunosuppressive complex that binds to and inhibits the activation of the mammalian Target Of Rapamycin (mTOR), a key regulatory kinase. This results in inhibition of T lymphocyte activation and proliferation that occurs in response to antigenic and cytokine (IL-2, IL-4, and IL-15) stimulation and inhibition of antibody production. Uses: Designed for use in research and industrial production. Additional or Alternative Names: RAPA; RAP; RPM; SLM; AY 22989; AY22989; AY-22989; SILA 9268A; WY090217; WY-090217; WY 090217; C07909; D00753; sirolimus; rapamycin; Rapamune. Product Category: Others. Appearance: White to off-white solid powder. CAS No. 53123-88-9. Molecular formula: C51H79NO13. Mole weight: 914.17. Purity: >98%. IUPACName: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34, 34a-hexadecahydro-9,27-dihydroxy-3-[(1R)-2-[(1S,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,27-epoxy-3H-pyrido[2,1-c][1,4] oxaazacyclohentriacontine-1,5,11,28,29 (4H,6H,31H)-pentone. Canonical SMILES: C[C@@H](C([C@H](OC)[C@H](O)/C(C)=C/[C@@H](C)C(C[C@@H]([C@H](C)C[C@@H]1CC[C@@H](O)C(OC)C1 | |
| Sirolimus trione isomer | Sirolimus trione isomer. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C51H79NO13. Mole Weight: 914.19. Catalog: APB09602. | |
Our database is helping our users find suppliers everyday.
